Loading Mouse GIF
Loading...

Strain Name:
C57BL/6N-Ace2em1(ACE2)MbpTmprss2em1(TMPRSS2)MbpSlc6a20bem1Mbp/Mmucd
Stock Number:
071888-UCD
Citation ID:
RRID:MMRRC_071888-UCD
Other Names:
C57BL/6N-Ace2em1(ACE2)MbpTmprss2em1(TMPRSS2)MbpSlc6a20bem1Mbp/Mmucd

Strain Information

QUALITY CONTROL OF C57BL/6N-Ace2em1(ACE2)MbpTmprss2em1(TMPRSS2)MbpSlc6a20bem1Mbp/Mmucd  |  University of California at Davis
Last Updated:
Strain Data and Information Information by Submitter Assessed by MMRRC1,2
Published Provided
Allele-specific genotype3 n.d.
Genetic background n.d.
Viability of genotypes available for distribution n.d.
Specific Pathogen- Status n.d.
Recoverability of cryopreserved sperm/embryos4 n.d.
Gene or allele sequence3 n.d.
Gene or allele expression3 n.d.
Gene or allele function3 n.d.
Observable and/or measurable phenotypes n.d.
Fertility of genotypes available for distribution n.d.
Fecundity/breeding performance n.d.

1 When indicated as verified ("YES"), then please note that information presented is to the best of our knowledge correct and up-to-date at the time of verification at the MMRRC Distribution Center; however, this information is subject to change due to breeding, maintenance, and other actions on the mouse strain at the MMRRC Distribution Center; direct any questions on this table to the MMRRC Distribution Center for this mouse stain.

2 If verification has not been performed (as indicated by "NO"), investigators may request specific verification testing for a fee. Requests should be submitted directly to the MMRRC Distribution Center assigned to the management, archiving, and distribution of the strain. A full listing of available testing and analytical services is available at https://www.mmrrc.org/about/services.php.

3 This information may or may not apply to each individual engineered allele (e.g., Cre, FlpO) present in the strain.

4 Recovery refers to thawing, in vitro fertilization (IVF), and/or embryo culture leading to live offspring.

Ace2em1(ACE2)Mbp
Name: angiotensin converting enzyme 2; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
Type: Allele
Species: Multi-species
Chromosome: X
Alteration at locus: CRISPR
Tmprss2em1(TMPRSS2)Mbp
Name: transmembrane protease, serine 2; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
Type: Allele
Species: Multi-species
Chromosome: 16
Alteration at locus: CRISPR
Slc6a20bem1Mbp
Name: solute carrier family 6 (neurotransmitter transporter), member 20B; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: CRISPR
Ace2
Name: angiotensin converting enzyme 2
Synonyms: 2010305L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 70008
Homologene: 41448
Tmprss2
Name: transmembrane protease, serine 2
Synonyms: epitheliasin, D16Ertd61e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50528
VEGA: 16
Homologene: 4136
Slc6a20b
Name: solute carrier family 6 (neurotransmitter transporter), member 20B
Synonyms: XT3, Xtrp3, Sit1, Slc6a20
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22599
Homologene: 130652
Genetic Alterations
Slc6a20b_5UTRG>T was created in the mouse to model the human 5’UTR variant caused by rs2271616. CRISPR RNP using guide CCTCGCTGCCTCAACCTCAC was used to assist with homology directed repair (HDR) using an ssODN repair template with the following single G>T SNP edit: AACCTCACAG(G/T)TGGCCAGTTT in the mouse 5’UTR and electroporated in mouse C57BL/6N-Ace2em1(ACE2)Mbp Tmprss2em1(TMPRSS2)Mbp zygotes. Founder animals were screened by QPCR MGB probe with positives subsequently PCR’d and bidirectionally sequenced at the loci.
Genotype Determination
ES Cell Line
Not applicable
Phenotype
Unknown
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Immunology and Inflammation
  • Models for Human Disease
Submitter
Kent Lloyd, D.V.M., University of California, Davis.
Primary Reference
Not ready to publish
Strain Development
Slc6a20b_5UTRG>T was created in the mouse to model the human 5’UTR variant caused by rs2271616. CRISPR RNP using guide CCTCGCTGCCTCAACCTCAC was used to assist with homology directed repair (HDR) using an ssODN repair template with the following single G>T SNP edit: AACCTCACAG(G/T)TGGCCAGTTT in the mouse 5’UTR and electroporated in mouse C57BL/6N-Ace2em1(ACE2)Mbp Tmprss2em1(TMPRSS2)Mbp zygotes. Founder animals were screened by QPCR MGB probe with positives subsequently PCR’d and bidirectionally sequenced at the loci. Sequence confirmed founder animals were then backcrossed to C57BL/6N-Ace2em1(ACE2)Mbp Tmprss2em1(TMPRSS2)Mbp and subsequence N1 Slc6a20b_5UTRG>T heterozygous animals were confirmed for copy number as well as sequence analysis. Potential off targets with an MIT score greater than 1.5 were not found.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

For more information about this colony's health status contact mmrrc@ucdavis.edu
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
Unknown
Overall Breeding Performance
Good
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes X-linked
Homozygotes are fertile: Yes X-linked
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
4 to 6
Recommended wean age
4 Weeks
Average Pups Weaned
4 to 6

Order Information

The availability level for this product has not been determined.

A Commercial License Agreement from the Submitter is required for for-profit entities to use this strain. For more information, please contactSteven Tudor.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

A Commercial License Agreement from the Submitter is required for for-profit entities to use this strain. For more information, please contact Steven Tudor

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.