Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Nacaem1Fsl/Mmjax
Stock Number:
075766-JAX
Citation ID:
RRID:MMRRC_075766-JAX
Other Names:
Naca AA

Strain Information

Nacaem1Fsl
Name: nascent polypeptide-associated complex alpha polypeptide; endonuclease-mediated mutation 1, Frank Lee
Synonyms: Naca(AA)
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Knock-In
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mouse
Chromosome: 10
Alteration at locus: Knock-In
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Genetic Alterations
NacaAA knock-in (KI) mice have two amino acid substitutions (L38A and E39A) in the Naca gene, resulting in modification of a PXLE motif which abolishes NACA interaction with PHD2. These mice may be useful when studying oxygen-sensing and the hypoxia-inducible factor (HIF) pathway.
ES Cell Line
Not applicable
Phenotype
Nascent polypeptide-associated complex alpha polypeptide (Naca) encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NACA), which binds to nascent proteins emerging from ribosomes. NACA is also implicated in modification of hypoxia-inducible factor alpha (HIF-α), which is a subunit of the hypoxia-inducible factor (HIF) complex. HIF is necessary for oxygen homeostasis by regulating metabolic adaptation, erythropoiesis (red blood cell production) and angiogenesis. NACA binds to PHD2, a prolyl hydroxylase domain protein, to enable co-translational modification of HIF-α. These NacaAA mice have two amino acid substitutions (L38A and E39A) in the Naca gene in a Pro-Xaa-Leu-Glu (PXLE) motif. This mutation abolishes the interaction between NACA and PHD2.

Heterozygous and homozygous mice are viable and fertile. Homozygous NacaAA mice display mild erythrocytosis. These mice may be useful for studying erythropoiesis and the HIF pathway.

MeSH Terms
  • Humans
  • Mice
  • Animals
  • Polycythemia/genetics
  • Polycythemia/metabolism
  • Hypoxia-Inducible Factor-Proline Dioxygenases/genetics
  • Hypoxia-Inducible Factor-Proline Dioxygenases/metabolism
  • Procollagen-Proline Dioxygenase/chemistry
  • Zinc Fingers
  • Hypoxia
  • Hypoxia-Inducible Factor 1, alpha Subunit/genetics
  • Hypoxia-Inducible Factor 1, alpha Subunit/metabolism
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Hematology
  • Research Tools
Donor
Frank Lee, M.D., Perelman School of Medicine, University of Pennsylvania.
Primary Reference

Song D, Peng K, Palmer BE, Lee FS. The ribosomal chaperone NACA recruits PHD2 to cotranslationally modify HIF-α. EMBO J. 2022 Nov 17;41(22):e112059. doi: 10.15252/embj.2022112059. Epub 2022 Oct 11. (Medline PMID: 36219563)

Strain Development
The NacaAA allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Two guide RNAs (TAGGAGTCTTGTTCCTCGAGCTC and AAACGAGCTCGAGGAACAAGACT), along with a single stranded oligodeoxynucleotide donor, were used to introduce two (L38A/E39A) amino acid substitutions in the nascent polypeptide-associated complex alpha polypeptide (Naca) gene on chromosome 10. Naca transcript Naca-201 (ENSMUST00000073868.9) was used as reference for the exon number and the guide sequences. Cas9 nuclease, gRNAs and single-stranded donor DNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The donating investigator notes that sequencing of six potential off-target loci, two with 1 mismatch to the gRNA sequence, one with 2 mismatches, and three with 3 mismatches did not reveal any other off-target effects of the gRNA. Founder mice were backcrossed to C57BL/6J mice for at least 3 generations by the donating laboratory. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N/A
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 10 to 12 months Greater than 12 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
075766-JAX-HOM-F
075766-JAX-HOM-M
075766-JAX-HET-F
075766-JAX-HET-M
075766-JAX-WT-F
075766-JAX-WT-M
Homozygous Female
Homozygous Male
Heterozygous / Hemizygous Female
Heterozygous / Hemizygous Male
Wild Type Female
Wild Type Male
$229.00 / Non-Profit Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.