Loading Mouse GIF
Loading...

Strain Name:
C57BL/6NCrl-Nvlem1(IMPC)Tcp/CmmrMmucd
Stock Number:
076205-UCD
Citation ID:
RRID:MMRRC_076205-UCD
Other Names:
AFQE
Major Collection:

Strain Information

Nvlem1(IMPC)Tcp
Name: nuclear VCP-like; endonuclease mediated 1, The Centre for Phenogenomics
Type: Allele
Species: Mus musculus (mouse)
Chromosome:
Alteration at locus: CRISPR
Nvl
Name: nuclear VCP-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome:
NCBI: 67459
HGNC: HGNC:8070
Homologene: 1902
Genetic Alterations
This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAGAACAGTCAGCCGGTCAC targeting the 5' side and targeting the 3' CAAGCCAATTCAATTAAGGG side of exons ENSMUSE00000160138, ENSMUSE00000160137, ENSMUSE00000160141, ENSMUSE00000160130, and ENSMUSE00000160122. This resulted in an 8468-bp deletion of Chr1 from 180951176 to 180959643 (GRCm39), introducing a frame shift and a premature stop codon.
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Lauryl Nutter, Ph.D., The Hospital for Sick Children.
Strain Development
Cas9 components were microinjected or electroporated into C57BL/6NCrl zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NCrl mice, and derived N1 progeny were identified by PCR and/or sequencing and subjected to quality control including allele sequencing. N1 mice passing QC were then backcrossed to C57BL/6NCrl mice to generate N2 mice identified by PCR. Mutant mice backcrossed at least 2 generations (N2 or more) were intercrossed to produce cohorts for phenotyping. Backcrossed (N2 or more) or intercrossed (N2F1 or more) heterozygous mice were used for cryopreservation.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

For more information about this colony's health status contact mmrrc@ucdavis.edu

Order Information

The availability level for this product has not been determined.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.