HNRNPH2R206W knock-in (KI) mice have a humanized exon 2, carrying the R206W missense variant, replacing equivalent mouse exon 4 in the heterogeneous nuclear ribonucleoprotein H2 (Hnrnph2) gene.

Not applicable

Homozygous females and hemizygous males are viable and fertile with no overt phenotype. Hnrnph2 is an X-linked gene. The donating laboratory indicates that homozygous females and hemizygous male mice are born in lower than expected Mendelian ratios from heterozygous x hemizygous breeding (~20.1% and 20.8%, respectively, n=154).

The HNRNPH2R206W knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs (GTATCAGGTCTAATTAACAG, TTATATGGACACACAGTAAC) were selected to excise and replace exon 4 of the murine heterogeneous nuclear ribonucleoprotein H2 (Hnrnph2) gene with human HNRNPH2 exon 2 harboring the R206W (CGG to TGG) missense variant, and 144bp upstream human intronic sequence. Hnrnph2 is on chromosome X. Mouse Hnrnph-202 transcript (ENSMUST00000059297.6) and human HNRNPH2-201 transcript (ENST00000316594.6) were used as references for the exon number and guide sequences. Guide RNAs, Cas9 nuclease, and the double stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females.

WT littermates or C57BL/6J

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.

Cat Lutz, Ph.D., The Jackson Laboratory.

Not ready to publish