Gldcindel mice have a 5bp deletion in exon 12 of the glycine decarboxylase (Gldc) gene.

Not applicable

Heterozygous mice are viable and fertile with no overt phenotype. The donating laboratory has not attempted to generate homozygous mice to date (April 2025).

The Gldcindel allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. A single guide RNA (ACACCTGATGAGTGAGGAAC) was selected to cleave DNA for the purpose of HDR-mediated genome editing for creating an R520S variant in the glycine decarboxylase (Gldc) gene on chromosome 19 (RRID:MMRRC 075819-JAX), and the Gldcindel allele was captured as a byproduct. The guide and (unincorporated) single stranded oligo donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

WT littermates and C57BL/6J inbred

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.

Cat Lutz, Ph.D., The Jackson Laboratory.

Not ready to publish