Med13lex15del mice have exons 15 deleted in the mediator complex subunit 13-like (Med13l) gene, resulting in a frameshift and early truncation at amino acid position 889.

Not applicable

Heterozygous are viable and fertile with no overt phenotype. Homozygous mice are perinatal lethal, as determined from heterozygous x heterozygous breeding (n=39).

The Med13lex15del allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing and was a byproduct when trying to create the Med13lP861L allele (RRID:MMRRC 75825-JAX). Guide RNAs (CTCGGGAGTGTGGCCGCCTG, GTTATTACCTTTATCTCCTC) were selected to excise murine exon 15, without replacement, of the mediator complex subunit 13-like (Med13l) gene on chromosome 5. Mouse Med13l-201 transcript (ENSMUST00000100816.8) was used as references for the exon number and guide sequences. The guide RNA, Cas9 nuclease, and double stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

Wt littermates or C57BL/6J inbred

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.

Cat Lutz, Ph.D., The Jackson Laboratory.

Not ready to publish