Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Echs1em3Lutzy/Mmjax
Stock Number:
076320-JAX
Citation ID:
RRID:MMRRC_076320-JAX
Other Names:
C57BL/6J-Echs1em3Lutzy/Mmjax

Strain Information

QUALITY CONTROL OF C57BL/6J-Echs1em3Lutzy/Mmjax  |  The Jackson Laboratory
Last Updated:
Strain Data and Information Information by Submitter Assessed by MMRRC1,2
Published Provided
Allele-specific genotype3n.d.
Genetic backgroundn.d.
Viability of genotypes available for distributionn.d.
Specific Pathogen- Status n.d.
Recoverability of cryopreserved sperm/embryos4 n.d.
Gene or allele sequence3n.d.
Gene or allele expression3n.d.
Gene or allele function3n.d.
Observable and/or measurable phenotypesn.d.
Fertility of genotypes available for distributionn.d.
Fecundity/breeding performance n.d.

1 When indicated as verified ("YES"), then please note that information presented is to the best of our knowledge correct and up-to-date at the time of verification at the MMRRC Distribution Center; however, this information is subject to change due to breeding, maintenance, and other actions on the mouse strain at the MMRRC Distribution Center; direct any questions on this table to the MMRRC Distribution Center for this mouse stain.

2 If verification has not been performed (as indicated by "NO"), investigators may request specific verification testing for a fee. Requests should be submitted directly to the MMRRC Distribution Center assigned to the management, archiving, and distribution of the strain. A full listing of available testing and analytical services is available at https://www.mmrrc.org/about/services.php.

3 This information may or may not apply to each individual engineered allele (e.g., Cre, FlpO) present in the strain.

4 Recovery refers to thawing, in vitro fertilization (IVF), and/or embryo culture leading to live offspring.

Echs1em3Lutzy
Name: enoyl Coenzyme A hydratase, short chain, 1, mitochondrial; endonuclease-mediated mutation 3, Cathy Lutz
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: CRISPR
Echs1
Name: enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 93747
HGNC: HGNC:3151
Homologene: 3018
Genetic Alterations
CRISPR/Cas9 technology generated a single base pair deletion, c.90delT (p.A31Lfs*19), resulting in a frameshift, ultimately inducing premature termination.
ES Cell Line
Not applicable
Phenotype
  • Heterozygous Echs1 null mice are viable, fertile, and do not exhibt an overt phenotype.
    • Brain liver and heart assessed by western blot at 2 months of age from heterozygotes were found to have less than half-normal levels of ECHS1 expression.
  • Heterozygous Echs1 null mice are embryonic lethal and do not produce any viable offspring.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Cell Biology
  • Metabolism
  • Models for Human Disease
  • Neurobiology
Submitter
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference

Eller MM, Zuberi AR, Fu X, Montalbano AP, Nitschke F, Burgess SC, Lutz C, Bailey RM. Neurological, metabolic and inflammatory phenotypes in a mouse model of ECHS1 deficiency. Brain Commun. 2025 Dec 12;7(6):fcaf487. doi: 10.1093/braincomms/fcaf487. (Medline PMID: 41426433)

Eller MM, Zuberi AR, Fu X, Burgess SC, Lutz CM, Bailey RM. Valine and Inflammation Drive Epilepsy in a Mouse Model of ECHS1 Deficiency. bioRxiv [Preprint]. 2024 Jun 13:2024.06.13.598697. doi: 10.1101/2024.06.13.598697. (Medline PMID: 38915588)

Strain Development
This single base pair deletion, c.90delT, which results in a frameshift and premature termination 19 amino acids later, was the byproduct of the CRISPR/cas9 targeting that generated the Echs1em1Lutzy F33S substitution. Single cell C57BL/6J zygotes were electroporated with Cas9 protein, sgRNA TGTACTGAAAGTTAGCACCT and a mutagenic donor oligonucleotide that contained a mutagenic F33S (TTT ->TCT) and two silent mutations to prevent reannealing, A31A (CGT->GCA) and Y35Y (TAC->TAT). This single base deletion frameshift was backcrossed from the founder to C57BL/6J for two consecutive generations and sperm was cryopreserved from heterozygous males at generation N2.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N2
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: N/A N/A
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 7 to 9 months 7 to 9 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
076320-JAX-SPERM Cryo-preserved spermatozoa $473.00 / $473.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
076320-JAX-RESUS Litter recovered from cryo-archive $2,187.00 / $2,187.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.