Loading Mouse GIF
Loading...

Strain Name:
B6.Cg Mir181d tm1.1Oers/Mmucd
Stock Number:
036959-UCD
Citation ID:
RRID:MMRRC_036959-UCD
Other Names:
miR-181d KO

Strain Information

Mir181dtm1.1Oers
Name: microRNA 181d; targeted mutation 1.1, Nicolai S C van Oers
Synonyms: Mir181d tm1Oers
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Knock-In
Mir181d
Name: microRNA 181d
Synonyms: mmu-mir-181d, Mirn181d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Knock-In
NCBI: 100049549
VEGA: 8
Genetic Alterations
Mir181d was modified by site-directed mutagenesis, eliminating the hairpin loop, introducing several additional nucleotide sequences and a new Pst I restriction site. The original sequence was acaattaacattcattgttgtcggtgggttg and the new sequence was acaattaagtgctaatgttgtccctgcagtgtg. A floxed neo selection cassette was subsequently removed by cre excision. Northern blot analhysis confirmed the lack of mature transcript without effecting expression of Mir181c.
ES Cell Line
LR2.6.1
Phenotype

Homozygous: phenotypes not fully characterized

Heterozygous: none noted

The targeted elimination of Mir181d resulted in a thymus stress-responsiveness similar to wild-type mice, suggesting that the four miR-181 family members have multiple overlapping functions. Gene expression experiments indicate that miR-181d targets a number of stress,metabolic, and signaling pathways.

Mammalian Phenotype Terms
Allelic Composition: Mir181dtm1.1Oers/Mir181dtm1.1Oers (Genetic Background: involves: C57BL/6 )

MeSH Terms
  • Animals
  • Base Sequence
  • CD4 Antigens/genetics
  • CD4 Antigens/immunology
  • CD8 Antigens/genetics
  • CD8 Antigens/immunology
  • Dexamethasone/pharmacology
  • Female
  • Gene Expression Profiling
  • Gene Expression Regulation
  • Lipopolysaccharides/pharmacology
  • Male
  • Mice
  • Mice, Transgenic
  • MicroRNAs/genetics
  • MicroRNAs/immunology
  • Molecular Sequence Data
  • Primary Cell Culture
  • Stress, Physiological
  • Thymocytes/drug effects
  • Thymocytes/immunology
  • Thymocytes/metabolism
  • Thymus Gland/drug effects
  • Thymus Gland/immunology
  • Thymus Gland/metabolism
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Cancer
  • Immunology and Inflammation
Donor
Nicolai S.C. van Oers, Ph.D., University of Texas Southwestern Medical Center.
Primary Reference
Belkaya S, van Oers NS. Transgenic expression of microRNA-181d augments the stress-sensitivity of CD4(+)CD8(+) thymocytes. PLoS One. 2014 Jan 9;9(1):e85274. eCollection 2014. (Medline PMID: 24416377).
Strain Development
Linearized targeted vector was electroporated into C57BL/6-derived LR2.6.1 ES cells. Selected ES cell clones were injected into C57BL/6 blastocyts. The resulting chimeric male mice were mated with C57BL/6 female mice. Following subsequent interbreeding between heterozygous mice, homozygous mice (miR-181d KIneo) were crossed with CAG-Cre transgenic lines (on a C57BL/6 background), eliminating the neomycin cassette and leaving a loxP site.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
Coat Color
Black
MMRRC Breeding System
Sib-mating
Breeding Scheme(s)

Homozygous female x Homozygous male littermate

Generation
F6
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: No No
Age Reproductive Decline: Unknown Unknown
Average litter size
5-9
Recommended wean age
3-4 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
036959-UCD-EMBRYO Cryo-preserved embryos $1,038.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
036959-UCD-SPERM Cryo-preserved spermatozoa $546.25 / Non-Profit Aliquot Approximate quantity3
036959-UCD-RESUS Litter recovered from cryo-archive $5,892.91 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.