Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0105Btlr/Mmmh
Stock Number:
038391-MU
Citation ID:
RRID:MMRRC_038391-MU
Other Names:
R0105 (G1), C57BL/6J-MtgxR0105Btlr
Major Collection:

Strain Information

Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: mHuC, Huc, 2600009P04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Neurog1
Name: neurogenin 1
Synonyms: neurogenin, Math4C, ngn1, neurogenin 1, Neurod3, bHLHa6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
HGNC: HGNC:7764
Homologene: 4490
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Cr1l
Name: complement C3b/C4b receptor 1 like
Synonyms: mCRY, Crry
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12946
Homologene: 128275
Ptdss2
Name: phosphatidylserine synthase 2
Synonyms: PSS2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27388
Homologene: 8462
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 20,523,732 bp
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • A to G, chromosome 1 at 59,582,474 bp
  • A to G, chromosome 1 at 78,523,670 bp
  • A to G, chromosome 1 at 90,798,161 bp
  • C to T, chromosome 1 at 119,687,605 bp
  • T to C, chromosome 1 at 156,690,570 bp
  • A to G, chromosome 1 at 195,112,412 bp
  • T to A, chromosome 2 at 11,730,648 bp
  • G to T, chromosome 2 at 32,213,311 bp
  • T to C, chromosome 2 at 60,514,981 bp
  • T to A, chromosome 2 at 88,817,909 bp
  • T to C, chromosome 2 at 89,528,363 bp
  • T to A, chromosome 2 at 90,890,363 bp
  • C to A, chromosome 2 at 121,077,012 bp
  • T to A, chromosome 2 at 121,977,320 bp
  • A to T, chromosome 2 at 151,589,558 bp
  • A to G, chromosome 3 at 89,876,818 bp
  • C to A, chromosome 4 at 48,468,957 bp
  • T to C, chromosome 4 at 106,711,270 bp
  • T to A, chromosome 4 at 130,349,306 bp
  • T to C, chromosome 4 at 141,469,810 bp
  • C to A, chromosome 4 at 156,218,225 bp
  • G to A, chromosome 5 at 22,048,815 bp
  • T to A, chromosome 5 at 37,284,135 bp
  • T to A, chromosome 5 at 129,849,894 bp
  • T to C, chromosome 6 at 38,053,129 bp
  • T to C, chromosome 6 at 60,402,152 bp
  • C to T, chromosome 6 at 73,155,279 bp
  • G to A, chromosome 6 at 87,819,185 bp
  • T to C, chromosome 6 at 124,541,318 bp
  • G to A, chromosome 6 at 133,294,314 bp
  • G to A, chromosome 6 at 140,591,747 bp
  • T to C, chromosome 7 at 28,547,038 bp
  • C to A, chromosome 7 at 46,288,366 bp
  • G to T, chromosome 7 at 66,292,341 bp
  • T to C, chromosome 7 at 97,299,072 bp
  • T to C, chromosome 7 at 132,630,525 bp
  • T to C, chromosome 7 at 141,152,880 bp
  • T to C, chromosome 8 at 72,492,571 bp
  • G to A, chromosome 8 at 91,522,802 bp
  • G to A, chromosome 8 at 105,382,012 bp
  • C to A, chromosome 9 at 22,036,833 bp
  • T to C, chromosome 9 at 71,656,102 bp
  • A to G, chromosome 10 at 7,798,446 bp
  • T to A, chromosome 10 at 21,395,539 bp
  • T to A, chromosome 10 at 42,930,599 bp
  • T to A, chromosome 10 at 76,499,534 bp
  • T to A, chromosome 11 at 65,821,985 bp
  • A to T, chromosome 11 at 68,490,511 bp
  • T to C, chromosome 11 at 116,126,066 bp
  • G to T, chromosome 13 at 56,251,237 bp
  • T to C, chromosome 14 at 45,610,690 bp
  • A to G, chromosome 14 at 75,722,140 bp
  • T to A, chromosome 15 at 8,187,392 bp
  • T to C, chromosome 15 at 57,822,695 bp
  • T to C, chromosome 15 at 63,828,177 bp
  • T to C, chromosome 15 at 79,620,832 bp
  • T to C, chromosome 15 at 101,884,912 bp
  • A to G, chromosome 16 at 4,288,388 bp
  • A to G, chromosome 17 at 34,187,275 bp
  • A to C, chromosome 17 at 35,556,138 bp
  • T to A, chromosome 17 at 43,040,191 bp
  • C to T, chromosome 17 at 48,302,828 bp
  • T to C, chromosome 18 at 20,602,054 bp
  • A to G, chromosome 18 at 36,646,766 bp
  • A to G, chromosome 19 at 3,993,121 bp
  • T to C, chromosome 19 at 8,160,627 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0105 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038391-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.