Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0164Btlr/Mmmh
Stock Number:
038440-MU
Citation ID:
RRID:MMRRC_038440-MU
Other Names:
R0164 (G1), C57BL/6J-MtgxR0164Btlr
Major Collection:

Strain Information

Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Wdr43
Name: WD repeat domain 43
Synonyms: 2610318G08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72515
VEGA: 17
Homologene: 38810
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 13,186,731 bp
  • T to A, chromosome 1 at 88,107,467 bp
  • T to C, chromosome 1 at 88,139,270 bp
  • A to G, chromosome 1 at 118,890,283 bp
  • A to T, chromosome 1 at 126,024,407 bp
  • T to C, chromosome 1 at 156,378,386 bp
  • A to G, chromosome 1 at 156,887,089 bp
  • G to T, chromosome 2 at 37,429,588 bp
  • C to T, chromosome 2 at 85,059,221 bp
  • C to T, chromosome 2 at 128,238,016 bp
  • TGC to TGCGC, chromosome 2 at 155,408,291 bp
  • A to T, chromosome 2 at 177,056,722 bp
  • G to A, chromosome 3 at 79,839,273 bp
  • A to T, chromosome 3 at 95,887,334 bp
  • A to T, chromosome 4 at 25,256,008 bp
  • A to T, chromosome 4 at 95,837,654 bp
  • A to G, chromosome 4 at 107,247,505 bp
  • A to T, chromosome 4 at 112,991,236 bp
  • T to C, chromosome 4 at 120,529,865 bp
  • G to T, chromosome 4 at 126,147,319 bp
  • A to G, chromosome 4 at 145,701,997 bp
  • T to C, chromosome 4 at 147,068,331 bp
  • T to C, chromosome 4 at 148,254,251 bp
  • G to T, chromosome 4 at 149,360,324 bp
  • G to T, chromosome 4 at 149,469,150 bp
  • T to C, chromosome 5 at 30,907,459 bp
  • T to C, chromosome 5 at 65,803,573 bp
  • T to C, chromosome 5 at 94,962,980 bp
  • T to C, chromosome 5 at 109,736,847 bp
  • T to G, chromosome 5 at 121,829,037 bp
  • G to A, chromosome 5 at 124,783,834 bp
  • T to A, chromosome 6 at 48,494,194 bp
  • G to A, chromosome 6 at 58,265,717 bp
  • T to A, chromosome 6 at 60,975,815 bp
  • C to T, chromosome 6 at 73,188,535 bp
  • A to G, chromosome 6 at 135,778,648 bp
  • G to A, chromosome 7 at 3,329,119 bp
  • T to A, chromosome 7 at 19,394,926 bp
  • T to A, chromosome 7 at 35,716,646 bp
  • G to A, chromosome 7 at 46,304,231 bp
  • T to A, chromosome 7 at 81,801,003 bp
  • T to G, chromosome 7 at 96,729,340 bp
  • T to A, chromosome 8 at 36,599,440 bp
  • T to C, chromosome 8 at 63,938,383 bp
  • T to C, chromosome 8 at 69,302,543 bp
  • T to G, chromosome 8 at 105,334,694 bp
  • A to T, chromosome 8 at 119,407,641 bp
  • C to T, chromosome 9 at 49,568,409 bp
  • T to A, chromosome 9 at 57,590,686 bp
  • G to A, chromosome 9 at 60,680,600 bp
  • T to C, chromosome 9 at 73,694,892 bp
  • T to C, chromosome 9 at 96,338,709 bp
  • T to A, chromosome 9 at 106,844,145 bp
  • T to C, chromosome 9 at 124,295,159 bp
  • A to T, chromosome 10 at 18,647,915 bp
  • A to T, chromosome 10 at 58,704,271 bp
  • GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC, chromosome 10 at 95,794,578 bp
  • A to T, chromosome 10 at 107,874,530 bp
  • T to A, chromosome 11 at 58,171,821 bp
  • C to T, chromosome 11 at 61,248,888 bp
  • C to A, chromosome 11 at 65,918,804 bp
  • A to T, chromosome 11 at 71,164,099 bp
  • T to C, chromosome 11 at 83,035,302 bp
  • T to C, chromosome 11 at 100,695,324 bp
  • A to G, chromosome 11 at 116,354,810 bp
  • G to A, chromosome 11 at 119,915,523 bp
  • A to T, chromosome 11 at 120,285,074 bp
  • C to T, chromosome 12 at 73,364,331 bp
  • G to A, chromosome 12 at 83,535,988 bp
  • A to G, chromosome 12 at 88,455,510 bp
  • A to G, chromosome 13 at 24,838,239 bp
  • A to T, chromosome 13 at 38,507,953 bp
  • C to A, chromosome 13 at 66,670,974 bp
  • G to T, chromosome 13 at 66,670,998 bp
  • G to A, chromosome 13 at 74,283,024 bp
  • T to A, chromosome 13 at 92,349,209 bp
  • A to G, chromosome 13 at 106,910,194 bp
  • T to C, chromosome 14 at 121,597,665 bp
  • A to G, chromosome 14 at 122,008,917 bp
  • T to C, chromosome 15 at 66,919,210 bp
  • C to T, chromosome 15 at 103,899,179 bp
  • A to G, chromosome 16 at 9,994,821 bp
  • T to C, chromosome 16 at 32,470,186 bp
  • T to C, chromosome 16 at 57,147,821 bp
  • G to A, chromosome 16 at 87,405,519 bp
  • T to A, chromosome 17 at 12,922,747 bp
  • A to C, chromosome 17 at 18,106,137 bp
  • A to G, chromosome 17 at 23,309,826 bp
  • A to G, chromosome 17 at 25,058,350 bp
  • G to A, chromosome 17 at 30,748,665 bp
  • T to G, chromosome 17 at 71,631,997 bp
  • A to G, chromosome 17 at 79,853,831 bp
  • T to C, chromosome 17 at 87,379,895 bp
  • T to A, chromosome 18 at 42,173,543 bp
  • A to G, chromosome 19 at 5,339,475 bp
  • A to G, chromosome 19 at 9,894,879 bp
  • A to G, chromosome 19 at 12,890,445 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0164 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038440-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.