Strain Detail Sheet
Strain Name:
C57BL/6J-MtgxR0164Btlr/Mmmh
Stock Number:
038440-MU
Citation ID:
RRID:MMRRC_038440-MU
Other Names:
R0164 (G1), C57BL/6J-MtgxR0164Btlr
Major Collection:
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2679272
NCBI: 268515
Ensembl: ENSMUSG00000039741
VEGA: OTTMUSG00000004133
HGNC: HGNC:29279
Homologene: 129585
CCDS: CCDS49003.1, CCDS83943.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:1354949
NCBI: 50768
Ensembl: ENSMUSG00000031523
VEGA: OTTMUSG00000028535
HGNC: HGNC:2897
Homologene: 4442
UCSC: Chr8:36567739-36953170
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:95728
NCBI: 14633
Ensembl: ENSMUSG00000048402
VEGA: OTTMUSG00000034815
HGNC: HGNC:4318
Homologene: 12725
CCDS: CCDS35692.1
UCSC: Chr1:118834061-119053619
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:2445220
NCBI: 321006
Ensembl: ENSMUSG00000040325
VEGA: OTTMUSG00000032620
HGNC: HGNC:30911
Homologene: 8805
CCDS: CCDS23485.1
UCSC: Chr9:106814169-106880992
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:106321
NCBI: 105445
Ensembl: ENSMUSG00000025558
VEGA: OTTMUSG00000061831
HGNC: HGNC:14132
Homologene: 41026
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Wdr43
Name: WD repeat domain 43
Synonyms: 2610318G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1919765
NCBI: 72515
Ensembl: ENSMUSG00000041057
VEGA: 17
HGNC: HGNC:28945
Homologene: 38810
CCDS: CCDS50180.1
UCSC: Chr17:71616174-71659031
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:2442377
NCBI: 76582
Ensembl: ENSMUSG00000042590
VEGA: OTTMUSG00000045106
HGNC: HGNC:20628
Homologene: 7089
CCDS: CCDS36776.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:1926163
NCBI: 78913
Ensembl: ENSMUSG00000052299
VEGA: 16
HGNC: HGNC:13082
Homologene: 32272
CCDS: CCDS37382.1
UCSC: Chr16:87376651-87432620
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ubac2
Name: ubiquitin associated domain containing 2
Synonyms: 1190008A14Rik, Phgdhl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
MGI: MGI:1916139
NCBI: 68889
Ensembl: ENSMUSG00000041765
VEGA: 14
HGNC: HGNC:20486
Homologene: 18642
CCDS: CCDS37019.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ube4b
Name: ubiquitination factor E4B
Synonyms: UFD2, 4933406G05Rik, 4930551I19Rik, UFD2a, Ufd2p, D4Bwg0973e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1927086
NCBI: 63958
Ensembl: ENSMUSG00000028960
VEGA: OTTMUSG00000010171
HGNC: HGNC:12500
Homologene: 107623
CCDS: CCDS18958.1
UCSC: Chr4:149328416-149426631
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dcaf4
Name: DDB1 and CUL4 associated factor 4
Synonyms: 1110018E21Rik, Wdr21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:1921078
NCBI: 73828
Ensembl: ENSMUSG00000021222
VEGA: 12
HGNC: HGNC:20229
Homologene: 9210
CCDS: CCDS26027.1
UCSC: Chr12:83520456-83541994
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ufl1
Name: UFM1 specific ligase 1
Synonyms: Rcad, Maxer, 1810074P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1914740
NCBI: 67490
Ensembl: ENSMUSG00000040359
VEGA: OTTMUSG00000004799
HGNC: HGNC:23039
Homologene: 9093
CCDS: CCDS18010.1
UCSC: Chr4:25247820-25281930
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ralgps2
Name: Ral GEF with PH domain and SH3 binding motif 2
Synonyms: 1810020P17Rik, 9130014M22Rik, 4921528G01Rik, 2210408F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:1925505
NCBI: 78255
Ensembl: ENSMUSG00000026594
VEGA: OTTMUSG00000049722
HGNC: HGNC:30279
Homologene: 23421
UCSC: Chr1:156804166-156939838
Genome Browser [Click image to go to Jbrowse]
Additional Resources
N4bp2
Name: NEDD4 binding protein 2
Synonyms: LOC333789, LOC386488, B3bp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:2684414
NCBI: 333789
Ensembl: ENSMUSG00000037795
VEGA: OTTMUSG00000022204
HGNC: HGNC:29851
Homologene: 32396
CCDS: CCDS19310.1
UCSC: Chr5:65763291-65830107
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tomm70a
Name: translocase of outer mitochondrial membrane 70A
Synonyms: D16Ium22, D16Ium22e, 2610044B22Rik, Tomm70a, D16Wsu109e, Tom70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:106295
NCBI: 28185
Ensembl: ENSMUSG00000022752
VEGA: 16
HGNC: HGNC:11985
Homologene: 40112
CCDS: CCDS28227.1
UCSC: Chr16:57121714-57154530
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nmnat1
Name: nicotinamide nucleotide adenylyltransferase 1
Synonyms: 5730441G13Rik, D4Cole1e, 2610529L11Rik, nicotinamide mononucleotide adenylyl transferase, nmnat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1913704
NCBI: 66454
Ensembl: ENSMUSG00000028992
VEGA: OTTMUSG00000010262
HGNC: HGNC:17877
Homologene: 39074
CCDS: CCDS18960.1
UCSC: Chr4:149468597-149485180
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfp980
Name: zinc finger protein 980
Synonyms: Gm13242
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:3712454
NCBI: 100041379
Ensembl: ENSMUSG00000058186
VEGA: OTTMUSG00000011070
HGNC: HGNC:28062
Homologene: 133076
CCDS: CCDS51370.1
UCSC: Chr4:145670697-145704437
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tdp2
Name: tyrosyl-DNA phosphodiesterase 2
Synonyms: D13Ertd656e, Ttrap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:1860486
NCBI: 56196
Ensembl: ENSMUSG00000035958
VEGA: OTTMUSG00000000605
HGNC: HGNC:17768
Homologene: 9591
CCDS: CCDS26381.1
UCSC: Chr13:24831659-24842153
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:97281
NCBI: 17967
Ensembl: ENSMUSG00000039542
VEGA: OTTMUSG00000052150
HGNC: HGNC:7656
Homologene: 40754
UCSC: Chr9:49502129-49799427
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:2447063
NCBI: 23966
Ensembl: ENSMUSG00000048078
VEGA: OTTMUSG00000021244
HGNC: HGNC:29945
Homologene: 8034
UCSC: Chr7:96171244-96911093
Genome Browser [Click image to go to Jbrowse]
Additional Resources
4930522L14Rik
Name: RIKEN cDNA 4930522L14 gene
Synonyms: Gm42152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1925270
NCBI: 100041734
Ensembl: ENSMUSG00000072762
VEGA: OTTMUSG00000022585
UCSC: Chr5:109677352-109796569
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tcp1
Name: t-complex protein 1
Synonyms: Ccta, c-cpn, TRic, CCT, Tcp-1, Tp63, p63, Cct1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:98535
NCBI: 21454
Ensembl: ENSMUSG00000068039
VEGA: OTTMUSG00000028087
HGNC: HGNC:11655
Homologene: 5656
CCDS: CCDS28397.1, CCDS70760.1
UCSC: Chr17:12916329-12925067
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:107714
NCBI: 13417
Ensembl: ENSMUSG00000033826
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
CCDS: CCDS37541.1
UCSC: Chr17:30626936-30875762
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Atp1b3
Name: ATPase, Na+/K+ transporting, beta 3 polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:107788
NCBI: 11933
Ensembl: ENSMUSG00000032412
VEGA: OTTMUSG00000047571
HGNC: HGNC:806
Homologene: 37510
CCDS: CCDS23414.1
UCSC: Chr9:96332662-96364299
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Msh3
Name: mutS homolog 3
Synonyms: D13Em1, Rep-3, Rep3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:109519
NCBI: 17686
Ensembl: ENSMUSG00000014850
VEGA: OTTMUSG00000047254
HGNC: HGNC:7326
Homologene: 1829
CCDS: CCDS49326.1, CCDS79222.1
UCSC: Chr13:92211878-92355003
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ncoa2
Name: nuclear receptor coactivator 2
Synonyms: TIF2/GRIP-1, Grip1, D1Ertd433e, glucocorticoid receptor-interacting protein 1, TIF2, TIF-2, SRC-2, KAT13C, bHLHe75
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:1276533
NCBI: 17978
Ensembl: ENSMUSG00000005886
VEGA: OTTMUSG00000021630
HGNC: HGNC:7669
Homologene: 4768
CCDS: CCDS35514.1, CCDS35515.1
UCSC: Chr1:13139105-13374083
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Incenp
Name: inner centromere protein
Synonyms: 2700067E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:1313288
NCBI: 16319
Ensembl: ENSMUSG00000024660
VEGA: 19
HGNC: HGNC:6058
Homologene: 9624
CCDS: CCDS37912.1
UCSC: Chr19:9872297-9899546
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Scmh1
Name: sex comb on midleg homolog 1
Synonyms: Scml3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1352762
NCBI: 29871
Ensembl: ENSMUSG00000000085
VEGA: OTTMUSG00000008809
HGNC: HGNC:19003
Homologene: 32146
CCDS: CCDS18589.1, CCDS51292.1
UCSC: Chr4:120405281-120530199
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Atl2
Name: atlastin GTPase 2
Synonyms: Aip-2, 2010110I21Rik, Arl6ip2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1929492
NCBI: 56298
Ensembl: ENSMUSG00000059811
VEGA: 17
HGNC: HGNC:24047
Homologene: 56949
CCDS: CCDS37700.1, CCDS37701.1
UCSC: Chr17:79848352-79896123
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Btbd1
Name: BTB (POZ) domain containing 1
Synonyms: 1190005H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1933765
NCBI: 83962
Ensembl: ENSMUSG00000025103
VEGA: OTTMUSG00000059194
HGNC: HGNC:1120
Homologene: 23529
CCDS: CCDS21407.1
UCSC: Chr7:81792074-81829499
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Txndc5
Name: thioredoxin domain containing 5
Synonyms: PC-TRP, ERp46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:2145316
NCBI: 105245
Ensembl: ENSMUSG00000038991
VEGA: OTTMUSG00000035033
HGNC: HGNC:21073
Homologene: 11125
UCSC: Chr13:38500266-38528824
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tnks1bp1
Name: tankyrase 1 binding protein 1
Synonyms: TAB182
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:2446193
NCBI: 228140
Ensembl: ENSMUSG00000033955
VEGA: OTTMUSG00000013461
HGNC: HGNC:19081
Homologene: 14117
CCDS: CCDS38166.1
UCSC: Chr2:85048013-85073048
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tmem204
Name: transmembrane protein 204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:3039635
NCBI: 407831
Ensembl: ENSMUSG00000024168
VEGA: OTTMUSG00000024887
HGNC: HGNC:14158
Homologene: 36419
CCDS: CCDS28506.1
UCSC: Chr17:25057702-25083553
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zfp640
Name: zinc finger protein 640
Synonyms: Mzf6d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:2678025
NCBI: 102636110
Ensembl: ENSMUSG00000074830
VEGA: 13
UCSC: Chr13:66668946-66680803
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Rnf157
Name: ring finger protein 157
Synonyms: A130073L17Rik, 2610036E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:2442484
NCBI: 217340
Ensembl: ENSMUSG00000052949
VEGA: OTTMUSG00000003842
HGNC: HGNC:29402
Homologene: 28235
CCDS: CCDS48984.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ccn4
Name: cellular communication network factor 4
Synonyms: Elm1, CCN4, Wisp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:1197008
NCBI: 22402
Ensembl: ENSMUSG00000005124
VEGA: OTTMUSG00000028045
HGNC: HGNC:12769
Homologene: 2883
CCDS: CCDS27510.1
UCSC: Chr15:66891325-66923205
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1860299
NCBI: 56087
Ensembl: ENSMUSG00000038011
VEGA: OTTMUSG00000034141
HGNC: HGNC:2941
Homologene: 25816
CCDS: CCDS51649.1
UCSC: Chr5:124725085-124834308
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:107744
NCBI: 330355
Ensembl: ENSMUSG00000052861
VEGA: OTTMUSG00000022156
HGNC: HGNC:2951
Homologene: 15221
CCDS: CCDS51813.1
UCSC: Chr6:73017606-73222403
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vmn1r28
Name: vomeronasal 1 receptor 28
Synonyms: V1rc25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:2159461
NCBI: 171198
Ensembl: ENSMUSG00000115705
VEGA: OTTMUSG00000039988
Homologene: 138094
CCDS: CCDS20193.1
UCSC: Chr6:58262294-58266082
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:3582959
NCBI: 637515
Ensembl: ENSMUSG00000070390
VEGA: OTTMUSG00000006087
HGNC: HGNC:14374
Homologene: 19080
CCDS: CCDS36210.1, CCDS48839.1
UCSC: Chr11:71153011-71242514
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Catsper1
Name: cation channel, sperm associated 1
Synonyms: KSper
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:2179947
NCBI: 225865
Ensembl: ENSMUSG00000038498
VEGA: 19
HGNC: HGNC:17116
Homologene: 14207
CCDS: CCDS29456.1
UCSC: Chr19:5335602-5344281
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ahrr
Name: aryl-hydrocarbon receptor repressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
MGI: MGI:1333776
NCBI: 11624
Ensembl: ENSMUSG00000021575
VEGA: OTTMUSG00000023058
HGNC: HGNC:346
Homologene: 49215
CCDS: CCDS26641.1, CCDS84037.1
UCSC: Chr13:74211117-74292331
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ncoa6
Name: nuclear receptor coactivator 6
Synonyms: PRIP, ASC2, RAP250, AIB3, NRC, ASC-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:1929915
NCBI: 56406
Ensembl: ENSMUSG00000038369
VEGA: OTTMUSG00000016062
HGNC: HGNC:15936
Homologene: 137337
CCDS: CCDS38295.1
UCSC: Chr2:155390656-155473894
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:2149021
NCBI: 208898
Ensembl: ENSMUSG00000062151
VEGA: OTTMUSG00000044794
HGNC: HGNC:23149
Homologene: 45443
CCDS: CCDS40690.1
UCSC: Chr9:73479422-74008154
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1289279
NCBI: 237806
Ensembl: ENSMUSG00000056752
VEGA: OTTMUSG00000005907
HGNC: HGNC:2953
Homologene: 20357
CCDS: CCDS36182.1
UCSC: Chr11:65831324-66170605
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ulk3
Name: unc-51-like kinase 3
Synonyms: 1200015E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:1918992
NCBI: 71742
Ensembl: ENSMUSG00000032308
VEGA: 9
HGNC: HGNC:19703
Homologene: 68482
CCDS: CCDS52809.1
UCSC: Chr9:57589129-57596233
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mlycd
Name: malonyl-CoA decarboxylase
Synonyms: Mcd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:1928485
NCBI: 56690
Ensembl: ENSMUSG00000074064
VEGA: OTTMUSG00000026334
HGNC: HGNC:7150
Homologene: 40821
CCDS: CCDS22703.1
UCSC: Chr8:119394419-119421940
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1202064
NCBI: 18419
Ensembl: ENSMUSG00000009487
VEGA: OTTMUSG00000058656
HGNC: HGNC:8516
Homologene: 8421
CCDS: CCDS52251.1
UCSC: Chr7:46240987-46311434
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:2686394
NCBI: 210356
Ensembl: ENSMUSG00000049690
VEGA: OTTMUSG00000030251
HGNC: HGNC:29847
Homologene: 35542
UCSC: Chr1:125913636-126830900
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Chmp6
Name: charged multivesicular body protein 6
Synonyms: 2400004G01Rik, chromatin modifying protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:3583942
NCBI: 208092
Ensembl: ENSMUSG00000025371
VEGA: OTTMUSG00000004028
HGNC: HGNC:25675
Homologene: 11607
CCDS: CCDS36385.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Prkcg
Name: protein kinase C, gamma
Synonyms: PKCgamma, Pkcc, Prkcc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:97597
NCBI: 18752
Ensembl: ENSMUSG00000078816
VEGA: OTTMUSG00000057714
HGNC: HGNC:9402
Homologene: 20602
CCDS: CCDS57470.1, CCDS80649.1
UCSC: Chr7:3303532-3331099
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: NMDAR2B, NR2B, Nmdar2b, GluRepsilon2, GluN2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:95821
NCBI: 14812
Ensembl: ENSMUSG00000030209
VEGA: OTTMUSG00000016356
HGNC: HGNC:4586
Homologene: 646
CCDS: CCDS20648.1
UCSC: Chr6:135729795-136173822
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Slfn10-ps
Name: schlafen 10, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:3512288
NCBI: 237887
Ensembl: ENSMUSG00000072621
VEGA: OTTMUSG00000000909
CCDS: CCDS36252.1
UCSC: Chr11:83028123-83040533
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Grin2a
Name: glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Synonyms: NR2A, NMDAR2A, GluRepsilon1, GluN2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:95820
NCBI: 14811
Ensembl: ENSMUSG00000059003
VEGA: OTTMUSG00000016264
HGNC: HGNC:4585
Homologene: 645
CCDS: CCDS27943.1
UCSC: Chr16:9577039-9996500
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:3649262
NCBI: 230622
Ensembl: ENSMUSG00000087194
VEGA: OTTMUSG00000008519
Homologene: 135888
CCDS: CCDS51269.1
UCSC: Chr4:112804503-113286973
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tmem208
Name: transmembrane protein 208
Synonyms: 2610030K20Rik, 1700006C06Rik, Hspc171
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:1913570
NCBI: 66320
Ensembl: ENSMUSG00000014856
VEGA: OTTMUSG00000022553
HGNC: HGNC:25015
Homologene: 40930
CCDS: CCDS22599.1
UCSC: Chr8:105326364-105335233
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Tmem144
Name: transmembrane protein 144
Synonyms: 1110057I03Rik, 5730537D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:1917902
NCBI: 70652
Ensembl: ENSMUSG00000027956
VEGA: OTTMUSG00000052194
HGNC: HGNC:25633
Homologene: 41250
CCDS: CCDS17421.1
UCSC: Chr3:79812564-79852789
Genome Browser [Click image to go to Jbrowse]
Additional Resources
4732465J04Rik
Name: RIKEN cDNA 4732465J04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:3041208
NCBI: 414105
Ensembl: ENSMUSG00000101517
VEGA: OTTMUSG00000046795
UCSC: Chr10:95773133-95794984
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:3647600
NCBI: 628870
Ensembl: ENSMUSG00000091455
VEGA: OTTMUSG00000043359
HGNC: HGNC:26901
Homologene: 46008
CCDS: CCDS56747.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:2674311
NCBI: 243369
Ensembl: ENSMUSG00000029797
VEGA: OTTMUSG00000045396
HGNC: HGNC:21998
Homologene: 45453
CCDS: CCDS57420.1
UCSC: Chr6:48446230-48501262
Genome Browser [Click image to go to Jbrowse]
Additional Resources
CAAA01180111.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Aldh3a2
Name: aldehyde dehydrogenase family 3, subfamily A2
Synonyms: Ahd-3, Ahd-3r, Ahd3-r, Ahd3, Aldh4, Aldh4-r, FALDH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1353452
NCBI: 11671
Ensembl: ENSMUSG00000010025
VEGA: OTTMUSG00000005829
HGNC: HGNC:403
Homologene: 55458
CCDS: CCDS24809.1
UCSC: Chr11:61224486-61267523
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:106387
NCBI: 215821
Ensembl: ENSMUSG00000019852
VEGA: 10
HGNC: HGNC:21213
Homologene: 41366
CCDS: CCDS23712.1
UCSC: Chr10:18588011-18743758
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dhx58
Name: DEXH (Asp-Glu-X-His) box polypeptide 58
Synonyms: B430001I08Rik, LPG2, D11Lgp2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1931560
NCBI: 80861
Ensembl: ENSMUSG00000017830
VEGA: OTTMUSG00000002055
HGNC: HGNC:29517
Homologene: 69371
CCDS: CCDS25431.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Adck1
Name: aarF domain containing kinase 1
Synonyms: 2610005A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:1919363
NCBI: 72113
Ensembl: ENSMUSG00000021044
VEGA: 12
HGNC: HGNC:19038
Homologene: 6493
CCDS: CCDS26087.1
UCSC: Chr12:88360491-88461726
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:3648252
NCBI: 666002
Ensembl: ENSMUSG00000091945
VEGA: OTTMUSG00000039964
Homologene: 86604
CCDS: CCDS50007.1
UCSC: Chr17:23290934-23312313
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Dpy19l3
Name: dpy-19-like 3 (C. elegans)
Synonyms: 9330164H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:2443952
NCBI: 233115
Ensembl: ENSMUSG00000043671
VEGA: OTTMUSG00000030802
HGNC: HGNC:27120
Homologene: 18692
CCDS: CCDS21155.1
UCSC: Chr7:35685500-35754454
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mmrn1
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
MGI: MGI:1918195
NCBI: 70945
Ensembl: ENSMUSG00000054641
VEGA: OTTMUSG00000034145
HGNC: HGNC:7178
Homologene: 49134
CCDS: CCDS51799.1, CCDS85058.1
UCSC: Chr6:60944317-60989378
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ugt1a6b
Name: UDP glucuronosyltransferase 1 family, polypeptide A6B
Synonyms: A9'
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:3580629
NCBI: 394435
Ensembl: ENSMUSG00000090145
VEGA: OTTMUSG00000020822
HGNC: HGNC:12538
Homologene: 85959
CCDS: CCDS48313.1
UCSC: Chr1:88103257-88218998
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ugt1a6a
Name: UDP glucuronosyltransferase 1 family, polypeptide A6A
Synonyms: UGT1.6, Ugt1a6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:2137698
NCBI: 94284
Ensembl: ENSMUSG00000054545
VEGA: OTTMUSG00000020818
HGNC: HGNC:12538
Homologene: 85959
CCDS: CCDS48314.1
UCSC: Chr1:88134809-88220002
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Axdnd1
Name: axonemal dynein light chain domain containing 1
Synonyms: LOC381304, 9430070O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
MGI: MGI:1924602
NCBI: 77352
Ensembl: ENSMUSG00000026601
VEGA: OTTMUSG00000023021
HGNC: HGNC:26564
Homologene: 52328
CCDS: CCDS15392.1, CCDS83611.1
UCSC: Chr1:156330415-156420915
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Zbtb6
Name: zinc finger and BTB domain containing 6
Synonyms: A830092L04Rik, Zfp482
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:2442998
NCBI: 241322
Ensembl: ENSMUSG00000066798
VEGA: OTTMUSG00000012652
HGNC: HGNC:16764
Homologene: 4829
CCDS: CCDS16000.1
UCSC: Chr2:37425500-37430919
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm14012
Name: predicted gene 14012
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3649274
Ensembl: ENSMUSG00000086879
VEGA: OTTMUSG00000015363
Gm14421
Name: predicted gene 14421
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
MGI: MGI:3652254
NCBI: 102639713
Ensembl: ENSMUSG00000083111
VEGA: OTTMUSG00000016589
UCSC: Chr2:177054064-177056510
Genome Browser [Click image to go to Jbrowse]
Additional Resources
C920021L13Rik
Name: RIKEN cDNA C920021L13 gene
Synonyms: 100042889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
MGI: MGI:1923991
NCBI: 100042889
Ensembl: ENSMUSG00000080727
VEGA: OTTMUSG00000031605
UCSC: Chr3:95871522-95889093
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Fggy
Name: FGGY carbohydrate kinase domain containing
Synonyms: 2310009E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1922828
NCBI: 75578
Ensembl: ENSMUSG00000028573
VEGA: OTTMUSG00000008049
HGNC: HGNC:25610
Homologene: 49535
CCDS: CCDS18365.1, CCDS51233.1
UCSC: Chr4:95557474-95926939
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lrrc42
Name: leucine rich repeat containing 42
Synonyms: A930011F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1925059
NCBI: 77809
Ensembl: ENSMUSG00000028617
VEGA: OTTMUSG00000008593
HGNC: HGNC:28792
Homologene: 12685
CCDS: CCDS18434.1
UCSC: Chr4:107233514-107253533
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm12946
Name: predicted gene 12946
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:3650946
Ensembl: ENSMUSG00000086961
VEGA: OTTMUSG00000009359
4933438K21Rik
Name: RIKEN cDNA 4933438K21 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:1918520
NCBI: 71270
Ensembl: ENSMUSG00000093617
VEGA: OTTMUSG00000040066
UCSC: Chr4:147063366-147068436
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Disp3
Name: dispatched RND transporter family member 3
Synonyms: G630052C06Rik, Ptchd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
MGI: MGI:2444403
NCBI: 242748
Ensembl: ENSMUSG00000041544
VEGA: OTTMUSG00000010955
HGNC: HGNC:29251
Homologene: 25712
CCDS: CCDS38966.1
UCSC: Chr4:148236433-148287965
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ost4
Name: oligosaccharyltransferase complex subunit 4 (non-catalytic)
Synonyms: 2310016E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:1914945
NCBI: 67695
Ensembl: ENSMUSG00000038803
VEGA: OTTMUSG00000022351
HGNC: HGNC:32483
CCDS: CCDS39049.1
UCSC: Chr5:30906516-30907810
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm7647
Name: predicted gene 7647
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:3779753
NCBI: 108169099
Ensembl: ENSMUSG00000073510
VEGA: OTTMUSG00000055685
UCSC: Chr5:94946526-94965697
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Sh2b3
Name: SH2B adaptor protein 3
Synonyms: Lnk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
MGI: MGI:893598
NCBI: 16923
Ensembl: ENSMUSG00000042594
VEGA: OTTMUSG00000029807
HGNC: HGNC:29605
Homologene: 36179
CCDS: CCDS19641.1, CCDS84952.1
UCSC: Chr5:121815481-121837650
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Klc3
Name: kinesin light chain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
MGI: MGI:1277971
NCBI: 232943
Ensembl: ENSMUSG00000040714
VEGA: OTTMUSG00000023189
HGNC: HGNC:20717
Homologene: 14899
CCDS: CCDS20901.1
UCSC: Chr7:19394440-19404448
Genome Browser [Click image to go to Jbrowse]
Additional Resources
AC149051.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
D130040H23Rik
Name: RIKEN cDNA D130040H23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
MGI: MGI:2444324
NCBI: 211135
Ensembl: ENSMUSG00000079038
VEGA: OTTMUSG00000062179
Homologene: 138403
CCDS: CCDS52565.1
UCSC: Chr8:69271053-69303384
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Lrrc49
Name: leucine rich repeat containing 49
Synonyms: D430025H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
MGI: MGI:2442689
NCBI: 102747
Ensembl: ENSMUSG00000047766
VEGA: OTTMUSG00000023677
HGNC: HGNC:25965
Homologene: 9782
UCSC: Chr9:60587224-60688322
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Gm6494
Name: predicted gene 6494
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
MGI: MGI:3644988
NCBI: 624335
Ensembl: ENSMUSG00000112424
VEGA: 10
UCSC: Chr10:58757370-58759471
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mrpl22
Name: mitochondrial ribosomal protein L22
Synonyms: MRP-L25, Rpml25, HSPC158, E030011D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
MGI: MGI:1333794
NCBI: 216767
Ensembl: ENSMUSG00000020514
VEGA: OTTMUSG00000005722
HGNC: HGNC:14480
Homologene: 56664
CCDS: CCDS24724.1
UCSC: Chr11:58170043-58179580
Genome Browser [Click image to go to Jbrowse]
Additional Resources
D830013O20Rik
Name: RIKEN cDNA D830013O20 gene
Synonyms: LOC380765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
MGI: MGI:2685737
NCBI: 380765
Ensembl: ENSMUSG00000056359
VEGA: 12
UCSC: Chr12:73364075-73409563
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Mucl2
Name: mucin-like 2
Synonyms: Spt-1, Spt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
MGI: MGI:98392
NCBI: 20770
Ensembl: ENSMUSG00000036925
VEGA: OTTMUSG00000056904
Homologene: 137219
CCDS: CCDS57015.1
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Pcyt1a
Name: phosphate cytidylyltransferase 1, choline, alpha isoform
Synonyms: CTalpha, CTP:phosphocholine cytidylyltransferase alpha, Ctpct, Cttalpha, Cctalpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
MGI: MGI:88557
NCBI: 13026
Ensembl: ENSMUSG00000005615
VEGA: OTTMUSG00000025786
HGNC: HGNC:8754
Homologene: 3680
CCDS: CCDS28120.1
UCSC: Chr16:32430921-32475065
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:3645072
NCBI: 665210
Ensembl: ENSMUSG00000091206
VEGA: OTTMUSG00000039015
Homologene: 115024
CCDS: CCDS49969.1
UCSC: Chr17:18085057-18136643
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Ttc7
Name: tetratricopeptide repeat domain 7
Synonyms: 1110035E02Rik, 1700007L07Rik, hea, fsn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
MGI: MGI:1920999
NCBI: 225049
Ensembl: ENSMUSG00000036918
VEGA: OTTMUSG00000028525
HGNC: HGNC:19750
Homologene: 12515
CCDS: CCDS29016.1
UCSC: Chr17:87282687-87381770
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Cstdc7
Name: cystatin domain containing 7
Synonyms: Gm5689
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
MGI: MGI:3647214
NCBI: 435561
Ensembl: ENSMUSG00000034339
VEGA: 18
UCSC: Chr18:42173370-42173735
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Olfr1446
Name: olfactory receptor 1446
Synonyms: GA_x6K02T2RE5P-3220047-3219130, MOR202-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
MGI: MGI:3031280
NCBI: 258699
Ensembl: ENSMUSG00000057817
VEGA: OTTMUSG00000059456
Homologene: 74233
CCDS: CCDS29642.1
UCSC: Chr19:12889649-12890575
Genome Browser [Click image to go to Jbrowse]
Additional Resources
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
- A to G, chromosome 1 at 13,186,731 bp
- T to A, chromosome 1 at 88,107,467 bp
- T to C, chromosome 1 at 88,139,270 bp
- A to G, chromosome 1 at 118,890,283 bp
- A to T, chromosome 1 at 126,024,407 bp
- T to C, chromosome 1 at 156,378,386 bp
- A to G, chromosome 1 at 156,887,089 bp
- G to T, chromosome 2 at 37,429,588 bp
- C to T, chromosome 2 at 85,059,221 bp
- C to T, chromosome 2 at 128,238,016 bp
- TGC to TGCGC, chromosome 2 at 155,408,291 bp
- A to T, chromosome 2 at 177,056,722 bp
- G to A, chromosome 3 at 79,839,273 bp
- A to T, chromosome 3 at 95,887,334 bp
- A to T, chromosome 4 at 25,256,008 bp
- A to T, chromosome 4 at 95,837,654 bp
- A to G, chromosome 4 at 107,247,505 bp
- A to T, chromosome 4 at 112,991,236 bp
- T to C, chromosome 4 at 120,529,865 bp
- G to T, chromosome 4 at 126,147,319 bp
- A to G, chromosome 4 at 145,701,997 bp
- T to C, chromosome 4 at 147,068,331 bp
- T to C, chromosome 4 at 148,254,251 bp
- G to T, chromosome 4 at 149,360,324 bp
- G to T, chromosome 4 at 149,469,150 bp
- T to C, chromosome 5 at 30,907,459 bp
- T to C, chromosome 5 at 65,803,573 bp
- T to C, chromosome 5 at 94,962,980 bp
- T to C, chromosome 5 at 109,736,847 bp
- T to G, chromosome 5 at 121,829,037 bp
- G to A, chromosome 5 at 124,783,834 bp
- T to A, chromosome 6 at 48,494,194 bp
- G to A, chromosome 6 at 58,265,717 bp
- T to A, chromosome 6 at 60,975,815 bp
- C to T, chromosome 6 at 73,188,535 bp
- A to G, chromosome 6 at 135,778,648 bp
- G to A, chromosome 7 at 3,329,119 bp
- T to A, chromosome 7 at 19,394,926 bp
- T to A, chromosome 7 at 35,716,646 bp
- G to A, chromosome 7 at 46,304,231 bp
- T to A, chromosome 7 at 81,801,003 bp
- T to G, chromosome 7 at 96,729,340 bp
- T to A, chromosome 8 at 36,599,440 bp
- T to C, chromosome 8 at 63,938,383 bp
- T to C, chromosome 8 at 69,302,543 bp
- T to G, chromosome 8 at 105,334,694 bp
- A to T, chromosome 8 at 119,407,641 bp
- C to T, chromosome 9 at 49,568,409 bp
- T to A, chromosome 9 at 57,590,686 bp
- G to A, chromosome 9 at 60,680,600 bp
- T to C, chromosome 9 at 73,694,892 bp
- T to C, chromosome 9 at 96,338,709 bp
- T to A, chromosome 9 at 106,844,145 bp
- T to C, chromosome 9 at 124,295,159 bp
- A to T, chromosome 10 at 18,647,915 bp
- A to T, chromosome 10 at 58,704,271 bp
- GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC, chromosome 10 at 95,794,578 bp
- A to T, chromosome 10 at 107,874,530 bp
- T to A, chromosome 11 at 58,171,821 bp
- C to T, chromosome 11 at 61,248,888 bp
- C to A, chromosome 11 at 65,918,804 bp
- A to T, chromosome 11 at 71,164,099 bp
- T to C, chromosome 11 at 83,035,302 bp
- T to C, chromosome 11 at 100,695,324 bp
- A to G, chromosome 11 at 116,354,810 bp
- G to A, chromosome 11 at 119,915,523 bp
- A to T, chromosome 11 at 120,285,074 bp
- C to T, chromosome 12 at 73,364,331 bp
- G to A, chromosome 12 at 83,535,988 bp
- A to G, chromosome 12 at 88,455,510 bp
- A to G, chromosome 13 at 24,838,239 bp
- A to T, chromosome 13 at 38,507,953 bp
- C to A, chromosome 13 at 66,670,974 bp
- G to T, chromosome 13 at 66,670,998 bp
- G to A, chromosome 13 at 74,283,024 bp
- T to A, chromosome 13 at 92,349,209 bp
- A to G, chromosome 13 at 106,910,194 bp
- T to C, chromosome 14 at 121,597,665 bp
- A to G, chromosome 14 at 122,008,917 bp
- T to C, chromosome 15 at 66,919,210 bp
- C to T, chromosome 15 at 103,899,179 bp
- A to G, chromosome 16 at 9,994,821 bp
- T to C, chromosome 16 at 32,470,186 bp
- T to C, chromosome 16 at 57,147,821 bp
- G to A, chromosome 16 at 87,405,519 bp
- T to A, chromosome 17 at 12,922,747 bp
- A to C, chromosome 17 at 18,106,137 bp
- A to G, chromosome 17 at 23,309,826 bp
- A to G, chromosome 17 at 25,058,350 bp
- G to A, chromosome 17 at 30,748,665 bp
- T to G, chromosome 17 at 71,631,997 bp
- A to G, chromosome 17 at 79,853,831 bp
- T to C, chromosome 17 at 87,379,895 bp
- T to A, chromosome 18 at 42,173,543 bp
- A to G, chromosome 19 at 5,339,475 bp
- A to G, chromosome 19 at 9,894,879 bp
- A to G, chromosome 19 at 12,890,445 bp
Genotype Determination
- Genotyping Protocol(s)
- Center protocol and contact for technical support will be shipped with mice.
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0164 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Colony Surveillance Program and Current Health Reports
Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
Click button to Request this one strain. (Use the
MMRRC Catalog Search to request more than one strain.)
| MMRRC Item # | Description | Distribution Fee / Unit (US $) | Units | Notes |
|---|---|---|---|---|
| 038440-MU-RESUS | Litter recovered from cryo-archive | $5,475.00 / Non-Profit | Litter | Recovered litter4; additional fees for any special requests. |
| Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information. | ||||
Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the
Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.