Strain Name:
C57BL/6J-MtgxR0164Btlr/Mmmh
Stock Number:
038440-MU
Citation ID:
RRID:MMRRC_038440-MU
Other Names:
R0164 (G1), C57BL/6J-MtgxR0164Btlr
Major Collection:

Strain Information

Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268515
Homologene: 129585
Dlc1
Name: deleted in liver cancer 1
Synonyms: Arhgap7, p122-RhoGAP, A730069N07Rik, STARD12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: Vprbp, B930007L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 321006
Homologene: 8805
Dock9
Name: dedicator of cytokinesis 9
Synonyms: D14Wsu89e, B230309H04Rik, Zizimin1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105445
Homologene: 41026
Wdr43
Name: WD repeat domain 43
Synonyms: 2610318G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72515
VEGA: 17
Homologene: 38810
Ipo11
Name: importin 11
Synonyms: 2510001A17Rik, E330021B14Rik, Ranbp11, 1700081H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76582
Homologene: 7089
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: Zfp294, Rnf160, Listerin, 4930528H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Ubac2
Name: ubiquitin associated domain containing 2
Synonyms: Phgdhl1, 1190008A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68889
VEGA: 14
Homologene: 18642
Ube4b
Name: ubiquitination factor E4B
Synonyms: 4930551I19Rik, 4933406G05Rik, D4Bwg0973e, Ufd2p, UFD2a, UFD2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 63958
Homologene: 107623
Dcaf4
Name: DDB1 and CUL4 associated factor 4
Synonyms: Wdr21, 1110018E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 73828
VEGA: 12
Homologene: 9210
Ufl1
Name: UFM1 specific ligase 1
Synonyms: Rcad, Maxer, 1810074P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67490
Homologene: 9093
Ralgps2
Name: Ral GEF with PH domain and SH3 binding motif 2
Synonyms: 4921528G01Rik, 1810020P17Rik, 9130014M22Rik, 2210408F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 78255
Homologene: 23421
N4bp2
Name: NEDD4 binding protein 2
Synonyms: LOC333789, LOC386488, B3bp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 333789
Homologene: 32396
Tomm70a
Name: translocase of outer mitochondrial membrane 70A
Synonyms: D16Ium22e, Tomm70a, Tom70, D16Wsu109e, 2610044B22Rik, D16Ium22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 28185
VEGA: 16
Homologene: 40112
Nmnat1
Name: nicotinamide nucleotide adenylyltransferase 1
Synonyms: nmnat, D4Cole1e, nicotinamide mononucleotide adenylyl transferase, 2610529L11Rik, 5730441G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66454
Homologene: 39074
Zfp980
Name: zinc finger protein 980
Synonyms: Gm13242
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100041379
Homologene: 133076
Tdp2
Name: tyrosyl-DNA phosphodiesterase 2
Synonyms: D13Ertd656e, Ttrap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56196
Homologene: 9591
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, E-NCAM, NCAM-180, NCAM-140, NCAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Ten-m4, ELM2, l(7)-3Rn, Odz4, Doc4, l7Rn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23966
Homologene: 8034
4930522L14Rik
Name: RIKEN cDNA 4930522L14 gene
Synonyms: Gm42152
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100041734
Tcp1
Name: t-complex protein 1
Synonyms: Cct1, Tcp-1, TRic, c-cpn, Ccta, p63, Tp63, CCT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21454
Homologene: 5656
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Dnahc8, P1-Loop, Hst6.7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Atp1b3
Name: ATPase, Na+/K+ transporting, beta 3 polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11933
HGNC: HGNC:806
Homologene: 37510
Msh3
Name: mutS homolog 3
Synonyms: Rep-3, Rep3, D13Em1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17686
HGNC: HGNC:7326
Homologene: 1829
Ncoa2
Name: nuclear receptor coactivator 2
Synonyms: SRC-2, Grip1, TIF2, glucocorticoid receptor-interacting protein 1, TIF-2, bHLHe75, D1Ertd433e, KAT13C, TIF2/GRIP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17978
HGNC: HGNC:7669
Homologene: 4768
Incenp
Name: inner centromere protein
Synonyms: 2700067E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 16319
VEGA: 19
HGNC: HGNC:6058
Homologene: 9624
Scmh1
Name: sex comb on midleg homolog 1
Synonyms: Scml3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 29871
Homologene: 32146
Atl2
Name: atlastin GTPase 2
Synonyms: 2010110I21Rik, Aip-2, Arl6ip2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 56298
VEGA: 17
Homologene: 56949
Btbd1
Name: BTB (POZ) domain containing 1
Synonyms: 1190005H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 83962
HGNC: HGNC:1120
Homologene: 23529
Txndc5
Name: thioredoxin domain containing 5
Synonyms: PC-TRP, ERp46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105245
Homologene: 11125
Tnks1bp1
Name: tankyrase 1 binding protein 1
Synonyms: TAB182
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228140
Homologene: 14117
Tmem204
Name: transmembrane protein 204
Synonyms: Clp24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 407831
Homologene: 36419
Zfp640
Name: zinc finger protein 640
Synonyms: Mzf6d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 102636110
VEGA: 13
Rnf157
Name: ring finger protein 157
Synonyms: 2610036E23Rik, A130073L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217340
Homologene: 28235
Ccn4
Name: cellular communication network factor 4
Synonyms: CCN4, Wisp1, Elm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 22402
Homologene: 2883
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Vmn1r28
Name: vomeronasal 1 receptor 28
Synonyms: V1rc25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171198
Homologene: 138094
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 637515
Homologene: 19080
Catsper1
Name: cation channel, sperm associated 1
Synonyms: KSper
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225865
VEGA: 19
Homologene: 14207
Ahrr
Name: aryl-hydrocarbon receptor repressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 11624
HGNC: HGNC:346
Homologene: 49215
Ncoa6
Name: nuclear receptor coactivator 6
Synonyms: PRIP, ASC2, ASC-2, RAP250, AIB3, NRC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56406
Homologene: 137337
Unc13c
Name: unc-13 homolog C
Synonyms: Unc13h3, Munc13-3, 1500037O19Rik, D9Ertd414e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208898
Homologene: 45443
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Ulk3
Name: unc-51-like kinase 3
Synonyms: 1200015E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71742
VEGA: 9
Homologene: 68482
Mlycd
Name: malonyl-CoA decarboxylase
Synonyms: Mcd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56690
HGNC: HGNC:7150
Homologene: 40821
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Nckap5
Name: NCK-associated protein 5
Synonyms: E030049G20Rik, LOC380609, D130011D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210356
Homologene: 35542
Chmp6
Name: charged multivesicular body protein 6
Synonyms: chromatin modifying protein 6, 2400004G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 208092
Homologene: 11607
Prkcg
Name: protein kinase C, gamma
Synonyms: Pkcc, Prkcc, PKCgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18752
HGNC: HGNC:9402
Homologene: 20602
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: Nmdar2b, GluN2B, NR2B, NMDAR2B, GluRepsilon2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Slfn10-ps
Name: schlafen 10, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237887
Grin2a
Name: glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Synonyms: GluRepsilon1, NR2A, NMDAR2A, GluN2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 14811
HGNC: HGNC:4585
Homologene: 645
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230622
Homologene: 135888
Tmem208
Name: transmembrane protein 208
Synonyms: Hspc171, 2610030K20Rik, 1700006C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66320
Homologene: 40930
Tmem144
Name: transmembrane protein 144
Synonyms: 5730537D05Rik, 1110057I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70652
Homologene: 41250
4732465J04Rik
Name: RIKEN cDNA 4732465J04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 414105
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 628870
Homologene: 46008
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243369
Homologene: 45453
CAAA01180111.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Aldh3a2
Name: aldehyde dehydrogenase family 3, subfamily A2
Synonyms: Aldh4-r, Ahd3-r, FALDH, Ahd-3, Ahd-3r, Ahd3, Aldh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11671
HGNC: HGNC:403
Homologene: 55458
Arfgef3
Name: ARFGEF family member 3
Synonyms: D10Bwg1379e, BIG3, B930094H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Dhx58
Name: DEXH (Asp-Glu-X-His) box polypeptide 58
Synonyms: D11Lgp2e, LPG2, B430001I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 80861
Homologene: 69371
Adck1
Name: aarF domain containing kinase 1
Synonyms: 2610005A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 72113
VEGA: 12
Homologene: 6493
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 666002
Homologene: 86604
Dpy19l3
Name: dpy-19-like 3 (C. elegans)
Synonyms: 9330164H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233115
Homologene: 18692
Mmrn1
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70945
HGNC: HGNC:7178
Homologene: 49134
Ugt1a6b
Name: UDP glucuronosyltransferase 1 family, polypeptide A6B
Synonyms: A9'
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 394435
Homologene: 85959
Ugt1a6a
Name: UDP glucuronosyltransferase 1 family, polypeptide A6A
Synonyms: Ugt1a6, UGT1.6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 94284
Homologene: 85959
Axdnd1
Name: axonemal dynein light chain domain containing 1
Synonyms: 9430070O13Rik, LOC381304
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77352
Homologene: 52328
Zbtb6
Name: zinc finger and BTB domain containing 6
Synonyms: A830092L04Rik, Zfp482
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241322
Homologene: 4829
Gm14012
Name: predicted gene 14012
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Gm14421
Name: predicted gene 14421
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 102639713
C920021L13Rik
Name: RIKEN cDNA C920021L13 gene
Synonyms: 100042889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 100042889
Fggy
Name: FGGY carbohydrate kinase domain containing
Synonyms: 2310009E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75578
Homologene: 49535
Lrrc42
Name: leucine rich repeat containing 42
Synonyms: A930011F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77809
Homologene: 12685
Gm12946
Name: predicted gene 12946
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
4933438K21Rik
Name: RIKEN cDNA 4933438K21 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 71270
Disp3
Name: dispatched RND transporter family member 3
Synonyms: G630052C06Rik, Ptchd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242748
Homologene: 25712
Ost4
Name: oligosaccharyltransferase complex subunit 4 (non-catalytic)
Synonyms: 2310016E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67695
Gm7647
Name: predicted gene 7647
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 108169099
Sh2b3
Name: SH2B adaptor protein 3
Synonyms: Lnk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16923
Homologene: 36179
Klc3
Name: kinesin light chain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232943
Homologene: 14899
AC149051.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
D130040H23Rik
Name: RIKEN cDNA D130040H23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 211135
Homologene: 138403
Lrrc49
Name: leucine rich repeat containing 49
Synonyms: D430025H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102747
Homologene: 9782
Gm6494
Name: predicted gene 6494
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 624335
VEGA: 10
Mrpl22
Name: mitochondrial ribosomal protein L22
Synonyms: HSPC158, E030011D16Rik, MRP-L25, Rpml25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216767
Homologene: 56664
D830013O20Rik
Name: RIKEN cDNA D830013O20 gene
Synonyms: LOC380765
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380765
VEGA: 12
Mucl2
Name: mucin-like 2
Synonyms: Spt-1, Spt1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20770
Homologene: 137219
Pcyt1a
Name: phosphate cytidylyltransferase 1, choline, alpha isoform
Synonyms: CTalpha, CTP:phosphocholine cytidylyltransferase alpha, Cttalpha, Ctpct, Cctalpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13026
HGNC: HGNC:8754
Homologene: 3680
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665210
Homologene: 115024
Ttc7
Name: tetratricopeptide repeat domain 7
Synonyms: 1110035E02Rik, 1700007L07Rik, fsn, hea
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 225049
Homologene: 12515
Cstdc7
Name: cystatin domain containing 7
Synonyms: Gm5689
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 435561
VEGA: 18
Or5b96
Name: olfactory receptor family 5 subfamily B member 96
Synonyms: MOR202-2, Olfr1446, GA_x6K02T2RE5P-3220047-3219130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258699
HGNC: HGNC:8324
Homologene: 74233
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 13,186,731 bp
  • T to A, chromosome 1 at 88,107,467 bp
  • T to C, chromosome 1 at 88,139,270 bp
  • A to G, chromosome 1 at 118,890,283 bp
  • A to T, chromosome 1 at 126,024,407 bp
  • T to C, chromosome 1 at 156,378,386 bp
  • A to G, chromosome 1 at 156,887,089 bp
  • G to T, chromosome 2 at 37,429,588 bp
  • C to T, chromosome 2 at 85,059,221 bp
  • C to T, chromosome 2 at 128,238,016 bp
  • TGC to TGCGC, chromosome 2 at 155,408,291 bp
  • A to T, chromosome 2 at 177,056,722 bp
  • G to A, chromosome 3 at 79,839,273 bp
  • A to T, chromosome 3 at 95,887,334 bp
  • A to T, chromosome 4 at 25,256,008 bp
  • A to T, chromosome 4 at 95,837,654 bp
  • A to G, chromosome 4 at 107,247,505 bp
  • A to T, chromosome 4 at 112,991,236 bp
  • T to C, chromosome 4 at 120,529,865 bp
  • G to T, chromosome 4 at 126,147,319 bp
  • A to G, chromosome 4 at 145,701,997 bp
  • T to C, chromosome 4 at 147,068,331 bp
  • T to C, chromosome 4 at 148,254,251 bp
  • G to T, chromosome 4 at 149,360,324 bp
  • G to T, chromosome 4 at 149,469,150 bp
  • T to C, chromosome 5 at 30,907,459 bp
  • T to C, chromosome 5 at 65,803,573 bp
  • T to C, chromosome 5 at 94,962,980 bp
  • T to C, chromosome 5 at 109,736,847 bp
  • T to G, chromosome 5 at 121,829,037 bp
  • G to A, chromosome 5 at 124,783,834 bp
  • T to A, chromosome 6 at 48,494,194 bp
  • G to A, chromosome 6 at 58,265,717 bp
  • T to A, chromosome 6 at 60,975,815 bp
  • C to T, chromosome 6 at 73,188,535 bp
  • A to G, chromosome 6 at 135,778,648 bp
  • G to A, chromosome 7 at 3,329,119 bp
  • T to A, chromosome 7 at 19,394,926 bp
  • T to A, chromosome 7 at 35,716,646 bp
  • G to A, chromosome 7 at 46,304,231 bp
  • T to A, chromosome 7 at 81,801,003 bp
  • T to G, chromosome 7 at 96,729,340 bp
  • T to A, chromosome 8 at 36,599,440 bp
  • T to C, chromosome 8 at 63,938,383 bp
  • T to C, chromosome 8 at 69,302,543 bp
  • T to G, chromosome 8 at 105,334,694 bp
  • A to T, chromosome 8 at 119,407,641 bp
  • C to T, chromosome 9 at 49,568,409 bp
  • T to A, chromosome 9 at 57,590,686 bp
  • G to A, chromosome 9 at 60,680,600 bp
  • T to C, chromosome 9 at 73,694,892 bp
  • T to C, chromosome 9 at 96,338,709 bp
  • T to A, chromosome 9 at 106,844,145 bp
  • T to C, chromosome 9 at 124,295,159 bp
  • A to T, chromosome 10 at 18,647,915 bp
  • A to T, chromosome 10 at 58,704,271 bp
  • GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC, chromosome 10 at 95,794,578 bp
  • A to T, chromosome 10 at 107,874,530 bp
  • T to A, chromosome 11 at 58,171,821 bp
  • C to T, chromosome 11 at 61,248,888 bp
  • C to A, chromosome 11 at 65,918,804 bp
  • A to T, chromosome 11 at 71,164,099 bp
  • T to C, chromosome 11 at 83,035,302 bp
  • T to C, chromosome 11 at 100,695,324 bp
  • A to G, chromosome 11 at 116,354,810 bp
  • G to A, chromosome 11 at 119,915,523 bp
  • A to T, chromosome 11 at 120,285,074 bp
  • C to T, chromosome 12 at 73,364,331 bp
  • G to A, chromosome 12 at 83,535,988 bp
  • A to G, chromosome 12 at 88,455,510 bp
  • A to G, chromosome 13 at 24,838,239 bp
  • A to T, chromosome 13 at 38,507,953 bp
  • C to A, chromosome 13 at 66,670,974 bp
  • G to T, chromosome 13 at 66,670,998 bp
  • G to A, chromosome 13 at 74,283,024 bp
  • T to A, chromosome 13 at 92,349,209 bp
  • A to G, chromosome 13 at 106,910,194 bp
  • T to C, chromosome 14 at 121,597,665 bp
  • A to G, chromosome 14 at 122,008,917 bp
  • T to C, chromosome 15 at 66,919,210 bp
  • C to T, chromosome 15 at 103,899,179 bp
  • A to G, chromosome 16 at 9,994,821 bp
  • T to C, chromosome 16 at 32,470,186 bp
  • T to C, chromosome 16 at 57,147,821 bp
  • G to A, chromosome 16 at 87,405,519 bp
  • T to A, chromosome 17 at 12,922,747 bp
  • A to C, chromosome 17 at 18,106,137 bp
  • A to G, chromosome 17 at 23,309,826 bp
  • A to G, chromosome 17 at 25,058,350 bp
  • G to A, chromosome 17 at 30,748,665 bp
  • T to G, chromosome 17 at 71,631,997 bp
  • A to G, chromosome 17 at 79,853,831 bp
  • T to C, chromosome 17 at 87,379,895 bp
  • T to A, chromosome 18 at 42,173,543 bp
  • A to G, chromosome 19 at 5,339,475 bp
  • A to G, chromosome 19 at 9,894,879 bp
  • A to G, chromosome 19 at 12,890,445 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0164 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038440-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.