Strain Name:
C57BL/6J-MtgxR0310Btlr/Mmmh
Stock Number:
038520-MU
Citation ID:
RRID:MMRRC_038520-MU
Other Names:
R0310 (G1), C57BL/6J-MtgxR0310Btlr
Major Collection:

Strain Information

Tk1
Name: thymidine kinase 1
Synonyms: D530002A18Rik, Tk-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21877
Homologene: 37749
Epha7
Name: Eph receptor A7
Synonyms: Ehk3, Cek11, Hek11, Mdk1, MDK1, Ebk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Med1
Name: mediator complex subunit 1
Synonyms: TRAP220, l11Jus15, PBP, Pparbp, TRAP 220, CRSP210, DRIP205
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTP-H1, PTPCL, 9530011I20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Katna1
Name: katanin p60 (ATPase-containing) subunit A1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23924
HGNC: HGNC:6216
Homologene: 56014
Tlk2
Name: tousled-like kinase 2 (Arabidopsis)
Synonyms: protein kinase U-alpha, PKUalpha, 4933403M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 24086
Homologene: 4993
Epc1
Name: enhancer of polycomb homolog 1
Synonyms: 5730566F07Rik, A930032N02Rik, 2400007E14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13831
Homologene: 32627
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107182
Homologene: 31978
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: Helic1, ASC1p200, B630009I04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Akap13
Name: A kinase anchor protein 13
Synonyms: PROTO-LB, 1700026G02Rik, 5830460E08Rik, 5730522G15Rik, Ht31, PROTO-LBC, AKAP-Lbc
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Ndufa9
Name: NADH:ubiquinone oxidoreductase subunit A9
Synonyms: 1010001N11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66108
HGNC: HGNC:7693
Homologene: 3666
Depdc1b
Name: DEP domain containing 1B
Synonyms: XTP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218581
Homologene: 10157
Afdn
Name: afadin, adherens junction formation factor
Synonyms: 5033403D15Rik, Afadin, I-afadin, Mllt4, S-afadin, AF6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Rttn
Name: rotatin
Synonyms: C530033I08Rik, 4921538A15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Inppl1
Name: inositol polyphosphate phosphatase-like 1
Synonyms: SHIP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16332
HGNC: HGNC:6080
Homologene: 1204
Arid4a
Name: AT-rich interaction domain 4A
Synonyms: Rbbp1, A630067N03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238247
HGNC: HGNC:9885
Homologene: 11303
Fanci
Name: Fanconi anemia, complementation group I
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 208836
Homologene: 49530
Zbtb20
Name: zinc finger and BTB domain containing 20
Synonyms: HOF, D16Wsu73e, 1300017A20Rik, 7330412A13Rik, Zfp288, A930017C21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56490
Homologene: 9226
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22772
Homologene: 5171
Lmbr1l
Name: limb region 1 like
Synonyms: D15Ertd735e, 1110013E13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74775
Homologene: 10011
Kcnn2
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonyms: SK2, small conductance calcium-activated potassium channel 2, bc, fri
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 140492
HGNC: HGNC:6291
Homologene: 135651
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Med13
Name: mediator complex subunit 13
Synonyms: 1110067M05Rik, Trap240, Thrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327987
Homologene: 21067
Dnaaf4
Name: dynein axonemal assembly factor 4
Synonyms: EKN1, b2b811Clo, Dyx1c1, 1700010I24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67685
Homologene: 12173
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Ddost
Name: dolichyl-di-phosphooligosaccharide-protein glycotransferase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13200
HGNC: HGNC:2728
Homologene: 3821
Ccdc50
Name: coiled-coil domain containing 50
Synonyms: 5730448P06Rik, D16Bwg1543e, 2610529H08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67501
Homologene: 69406
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70472
VEGA: 15
Homologene: 6044
Akap8
Name: A kinase anchor protein 8
Synonyms: AKAP95, 1200016A02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56399
VEGA: 17
HGNC: HGNC:378
Homologene: 4278
Nbeal1
Name: neurobeachin like 1
Synonyms: A530083I02Rik, A530050O19Rik, 2310076G13Rik, ALS2CR17
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Dennd2a
Name: DENN domain containing 2A
Synonyms: B930096L08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209773
Homologene: 35238
Tmtc1
Name: transmembrane and tetratricopeptide repeat containing 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387314
Homologene: 65299
Cyp4f18
Name: cytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms: 1810054N16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72054
Homologene: 128623
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b3491Clo, Mdnah5, b2b1537Clo, b2b1134Clo, Dnahc5, b2b1154Clo, b2b1565Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Wdr87-ps
Name: WD repeat domain 87, pseudogene
Synonyms: 4932431P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 114675
Or8b101
Name: olfactory receptor family 8 subfamily B member 101
Synonyms: MOR162-4, Olfr888, GA_x6K02T2PVTD-31787920-31788864
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258416
Homologene: 84577
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: fibrocystin L, D86 mRNA, PKHDL1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Ahrr
Name: aryl-hydrocarbon receptor repressor
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11624
HGNC: HGNC:346
Homologene: 49215
Nav3
Name: neuron navigator 3
Synonyms: POMFIL1, steerin 3, unc53H3, Pomfil1p, 9630020C08Rik, 4732483H20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Ints15
Name: integrator complex subunit 15
Synonyms: E130309D02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231868
Homologene: 11445
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Birc1b, Naip2, Naip-rs6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Stab2
Name: stabilin 2
Synonyms: FEEL-2, STAB-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100125586
Homologene: 129753
Kcnh4
Name: potassium voltage-gated channel, subfamily H (eag-related), member 4
Synonyms: BEC2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380728
HGNC: HGNC:6253
Homologene: 8180
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4, Birc1f, Naip-rs4A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Trim14
Name: tripartite motif-containing 14
Synonyms: 5830400N10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74735
Homologene: 13241
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 4930518F03Rik, 3830402K23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Unc79
Name: unc-79 homolog
Synonyms: Mlca3, 9030205A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Cgn
Name: cingulin
Synonyms: 6330408J11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70737
Homologene: 41394
Fetub
Name: fetuin beta
Synonyms: 2310011O17Rik, D17980
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 59083
VEGA: 16
HGNC: HGNC:3658
Homologene: 8660
Jag2
Name: jagged 2
Synonyms: D12Ggc2e, Serh
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16450
VEGA: 12
HGNC: HGNC:6189
Homologene: 1677
Gne
Name: glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms: 2310066H07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50798
Homologene: 3996
Pxdn
Name: peroxidasin
Synonyms: VPO1, 2310075M15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Tspan15
Name: tetraspanin 15
Synonyms: Tm4sf15, 2700063A19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70423
VEGA: 10
Homologene: 22716
Or6c209
Name: olfactory receptor family 6 subfamily C member 209
Synonyms: GA_x6K02T2PULF-11325750-11326685, MOR114-2, Olfr799
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258929
Homologene: 37000
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 116904
Homologene: 10813
Ppp1r18
Name: protein phosphatase 1, regulatory subunit 18
Synonyms: 2310014H01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76448
Homologene: 19512
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: C130038G02Rik, 5730592G18Rik, A730013O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77521
Homologene: 78141
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 666002
Homologene: 86604
Cebpz
Name: CCAAT/enhancer binding protein zeta
Synonyms: Cebpa-rs1, CBF2, Cbf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12607
VEGA: 17
Homologene: 4210
Mpeg1
Name: macrophage expressed gene 1
Synonyms: MPS1, Perforin-2, Mpg-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17476
VEGA: 19
Homologene: 11216
Siah3
Name: siah E3 ubiquitin protein ligase family member 3
Synonyms: LOC380918
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380918
VEGA: 14
Homologene: 54375
Chil3
Name: chitinase-like 3
Synonyms: Ym1, Chi3l3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12655
Homologene: 74931
Daam2
Name: dishevelled associated activator of morphogenesis 2
Synonyms: 2310016D11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76441
VEGA: 17
Homologene: 69186
Ttc7
Name: tetratricopeptide repeat domain 7
Synonyms: 1700007L07Rik, 1110035E02Rik, fsn, hea
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225049
Homologene: 12515
Nr0b2
Name: nuclear receptor subfamily 0, group B, member 2
Synonyms: SHP, SHP-1, small heterodimer partner
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 23957
HGNC: HGNC:7961
Homologene: 8030
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
Fbxo8
Name: F-box protein 8
Synonyms: Fbx8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50753
Homologene: 8137
Sval3
Name: seminal vesicle antigen-like 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387564
Homologene: 133811
Ppm1l
Name: protein phosphatase 1 (formerly 2C)-like
Synonyms: PP2C-epsilon, Pp2ce, 5930404J21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242083
Homologene: 33158
Ttll6
Name: tubulin tyrosine ligase-like family, member 6
Synonyms: t8130b59, 4932418K24Rik, D11Moh43e, D11Moh44e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237930
Homologene: 18229
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: E030024J03Rik, IDPc, Id-1, Idh-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
Rbm12
Name: RNA binding motif protein 12
Synonyms: 9430070C08Rik, SWAN, 5730420G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Bbs12
Name: Bardet-Biedl syndrome 12
Synonyms: LOC241950, LOC386537, LOC241950
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241950
Homologene: 17634
Vmn2r4
Name: vomeronasal 2, receptor 4
Synonyms: EG637053
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637053
Homologene: 129754
Sprr2k
Name: small proline-rich protein 2K
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20765
Slc22a15
Name: solute carrier family 22 (organic anion/cation transporter), member 15
Synonyms: A530052I06Rik, 2610034P21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242126
Homologene: 41263
Gm15886
Name: predicted gene 15886
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 102637354
Vcam1
Name: vascular cell adhesion molecule 1
Synonyms: CD106, Vcam-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22329
Homologene: 838
Barhl2
Name: BarH like homeobox 2
Synonyms: E130309B19Rik, MBH1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 104382
HGNC: HGNC:954
Homologene: 10572
Akr1b8
Name: aldo-keto reductase family 1, member B8
Synonyms: Fgrp, Fgfrp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14187
Homologene: 116462
Vmn1r10
Name: vomeronasal 1 receptor 10
Synonyms: V1rc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113858
Homologene: 76459
Ino80b
Name: INO80 complex subunit B
Synonyms: Hmga1l4, Znhit4, HMG1YL4, 2510009I23Rik, Papa1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70020
Homologene: 32566
Vmn1r80
Name: vomeronasal 1 receptor 80
Synonyms: V1rg3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171238
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Nalp5, Op1, Mater
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23968
Homologene: 65105
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Gprc2a-rs3, EG637898, Casr-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Cdh15
Name: cadherin 15
Synonyms: M cadherin, Mcad, Cdh14
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Or1m1
Name: olfactory receptor family 1 subfamily M member 1
Synonyms: MOR132-1, MTPCR51, GA_x6K02T2PVTD-12498544-12497603, Olfr24
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18322
HGNC: HGNC:8220
Homologene: 64896
4930550C14Rik
Name: RIKEN cDNA 4930550C14 gene
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75311
VEGA: 9
Homologene: 12595
Ip6k2
Name: inositol hexaphosphate kinase 2
Synonyms: 1500005N04Rik, Ihpk2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76500
Homologene: 56929
Zkscan7
Name: zinc finger with KRAB and SCAN domains 7
Synonyms: Zfp167
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382118
VEGA: 9
Homologene: 83284
Ccr9
Name: C-C motif chemokine receptor 9
Synonyms: Cmkbr10, GPR-9-6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12769
HGNC: HGNC:1610
Homologene: 22546
Il22b
Name: interleukin 22B
Synonyms: IL-TIFb, Iltifb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116849
Homologene: 9669
Or6c69c
Name: olfactory receptor family 6 subfamily C member 69C
Synonyms: GA_x6K02T2PULF-11745102-11746040, MOR113-2, Olfr822
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258666
Homologene: 133890
Ankrd13b
Name: ankyrin repeat domain 13b
Synonyms: B930093C12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268445
Homologene: 27367
Dusp22
Name: dual specificity phosphatase 22
Synonyms: JKAP, JSP1, 1110028K04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105352
Homologene: 86039
Khnyn
Name: KH and NYN domain containing
Synonyms: 9130227C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219094
VEGA: 14
Homologene: 23611
Abcc1
Name: ATP-binding cassette, sub-family C member 1
Synonyms: Abcc1b, Mdrap, Mrp1, Abcc1a, MRP
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: P21cdc42Hs kinase, Pyk1, activated p21cdc42Hs kinase, ACK1, Ack
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 51789
Homologene: 4224
Trim15
Name: tripartite motif-containing 15
Synonyms: 1810012B10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69097
Homologene: 23819
Frs3
Name: fibroblast growth factor receptor substrate 3
Synonyms: Frs2beta, 4930417B13Rik, SNT2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 107971
Homologene: 4845
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 20,549,822 bp
  • T to C, chromosome 1 at 60,305,370 bp
  • T to C, chromosome 1 at 65,161,920 bp
  • T to A, chromosome 2 at 125,363,644 bp
  • A to G, chromosome 2 at 156,095,724 bp
  • C to G, chromosome 2 at 178,381,855 bp
  • G to T, chromosome 2 at 180,181,566 bp
  • T to A, chromosome 3 at 37,321,045 bp
  • A to T, chromosome 3 at 64,134,618 bp
  • A to T, chromosome 3 at 64,389,434 bp
  • A to G, chromosome 3 at 69,549,461 bp
  • A to T, chromosome 3 at 92,433,463 bp
  • C to T, chromosome 3 at 94,765,653 bp
  • G to T, chromosome 3 at 101,860,511 bp
  • T to A, chromosome 3 at 103,777,335 bp
  • T to A, chromosome 3 at 106,160,523 bp
  • A to T, chromosome 3 at 116,114,416 bp
  • A to G, chromosome 4 at 28,961,301 bp
  • C to A, chromosome 4 at 44,060,157 bp
  • C to A, chromosome 4 at 46,522,043 bp
  • A to T, chromosome 4 at 57,204,958 bp
  • C to A, chromosome 4 at 133,555,992 bp
  • T to A, chromosome 4 at 138,310,611 bp
  • G to T, chromosome 5 at 106,457,387 bp
  • G to T, chromosome 5 at 113,263,705 bp
  • G to T, chromosome 5 at 143,307,888 bp
  • T to C, chromosome 5 at 148,107,019 bp
  • T to C, chromosome 6 at 34,365,259 bp
  • C to T, chromosome 6 at 39,464,201 bp
  • T to C, chromosome 6 at 40,761,035 bp
  • T to A, chromosome 6 at 41,968,186 bp
  • A to T, chromosome 6 at 57,113,501 bp
  • T to C, chromosome 6 at 83,124,091 bp
  • G to T, chromosome 6 at 126,827,532 bp
  • T to C, chromosome 6 at 148,249,581 bp
  • T to A, chromosome 7 at 10,159,466 bp
  • A to G, chromosome 7 at 12,193,848 bp
  • G to T, chromosome 7 at 23,430,157 bp
  • G to T, chromosome 7 at 28,142,274 bp
  • A to G, chromosome 7 at 29,532,000 bp
  • G to T, chromosome 7 at 42,195,140 bp
  • T to A, chromosome 7 at 45,336,497 bp
  • A to G, chromosome 7 at 75,614,930 bp
  • C to T, chromosome 7 at 79,407,417 bp
  • C to G, chromosome 7 at 81,078,610 bp
  • A to T, chromosome 7 at 101,828,499 bp
  • T to A, chromosome 8 at 56,590,097 bp
  • C to T, chromosome 8 at 72,001,012 bp
  • A to T, chromosome 8 at 112,842,516 bp
  • A to G, chromosome 8 at 122,865,436 bp
  • A to G, chromosome 9 at 7,561,454 bp
  • T to A, chromosome 9 at 18,755,333 bp
  • T to A, chromosome 9 at 38,109,486 bp
  • A to C, chromosome 9 at 53,425,671 bp
  • A to T, chromosome 9 at 62,760,346 bp
  • A to T, chromosome 9 at 72,972,336 bp
  • T to C, chromosome 9 at 108,799,233 bp
  • C to A, chromosome 9 at 110,638,163 bp
  • G to T, chromosome 9 at 122,888,893 bp
  • A to T, chromosome 9 at 123,774,552 bp
  • G to T, chromosome 10 at 7,743,749 bp
  • G to T, chromosome 10 at 50,748,926 bp
  • T to A, chromosome 10 at 62,188,093 bp
  • G to A, chromosome 10 at 86,967,613 bp
  • T to C, chromosome 10 at 109,767,128 bp
  • T to A, chromosome 10 at 118,293,185 bp
  • T to A, chromosome 10 at 129,647,731 bp
  • G to A, chromosome 10 at 130,074,823 bp
  • T to C, chromosome 11 at 9,293,810 bp
  • A to G, chromosome 11 at 77,472,745 bp
  • A to T, chromosome 11 at 86,346,003 bp
  • A to T, chromosome 11 at 96,147,556 bp
  • A to G, chromosome 11 at 98,167,574 bp
  • G to T, chromosome 11 at 100,746,169 bp
  • C to A, chromosome 11 at 105,254,973 bp
  • T to C, chromosome 11 at 117,817,095 bp
  • T to C, chromosome 12 at 30,015,529 bp
  • T to C, chromosome 12 at 71,075,830 bp
  • A to G, chromosome 12 at 103,061,407 bp
  • G to T, chromosome 12 at 112,913,377 bp
  • T to C, chromosome 13 at 30,705,658 bp
  • G to A, chromosome 13 at 74,283,024 bp
  • T to A, chromosome 13 at 100,148,842 bp
  • A to G, chromosome 13 at 100,308,213 bp
  • A to T, chromosome 13 at 102,754,161 bp
  • G to A, chromosome 13 at 108,373,841 bp
  • A to G, chromosome 14 at 55,887,968 bp
  • A to G, chromosome 14 at 75,525,927 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • A to T, chromosome 15 at 28,299,110 bp
  • A to G, chromosome 15 at 44,522,738 bp
  • G to A, chromosome 15 at 58,114,257 bp
  • A to T, chromosome 15 at 98,908,773 bp
  • T to A, chromosome 16 at 14,410,927 bp
  • T to C, chromosome 16 at 22,929,756 bp
  • T to A, chromosome 16 at 27,406,658 bp
  • C to T, chromosome 16 at 32,680,590 bp
  • T to C, chromosome 16 at 43,609,746 bp
  • G to T, chromosome 17 at 13,885,508 bp
  • A to T, chromosome 17 at 23,290,943 bp
  • A to T, chromosome 17 at 32,316,260 bp
  • T to C, chromosome 17 at 35,873,711 bp
  • A to C, chromosome 17 at 36,866,986 bp
  • T to C, chromosome 17 at 47,703,822 bp
  • A to G, chromosome 17 at 49,463,924 bp
  • T to C, chromosome 17 at 78,926,124 bp
  • T to A, chromosome 17 at 87,361,864 bp
  • A to G, chromosome 18 at 6,440,202 bp
  • T to G, chromosome 18 at 45,560,518 bp
  • A to T, chromosome 18 at 89,009,460 bp
  • C to A, chromosome 19 at 12,461,691 bp
  • A to G, chromosome 19 at 37,004,534 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0310 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038520-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.