MMRRC:038520-MU

A to T, chromosome 1 at 20,549,822 bp
T to C, chromosome 1 at 60,305,370 bp
T to C, chromosome 1 at 65,161,920 bp
T to A, chromosome 2 at 125,363,644 bp
A to G, chromosome 2 at 156,095,724 bp
C to G, chromosome 2 at 178,381,855 bp
G to T, chromosome 2 at 180,181,566 bp
T to A, chromosome 3 at 37,321,045 bp
A to T, chromosome 3 at 64,134,618 bp
A to T, chromosome 3 at 64,389,434 bp
A to G, chromosome 3 at 69,549,461 bp
A to T, chromosome 3 at 92,433,463 bp
C to T, chromosome 3 at 94,765,653 bp
G to T, chromosome 3 at 101,860,511 bp
T to A, chromosome 3 at 103,777,335 bp
T to A, chromosome 3 at 106,160,523 bp
A to T, chromosome 3 at 116,114,416 bp
A to G, chromosome 4 at 28,961,301 bp
C to A, chromosome 4 at 44,060,157 bp
C to A, chromosome 4 at 46,522,043 bp
A to T, chromosome 4 at 57,204,958 bp
C to A, chromosome 4 at 133,555,992 bp
T to A, chromosome 4 at 138,310,611 bp
G to T, chromosome 5 at 106,457,387 bp
G to T, chromosome 5 at 113,263,705 bp
G to T, chromosome 5 at 143,307,888 bp
T to C, chromosome 5 at 148,107,019 bp
T to C, chromosome 6 at 34,365,259 bp
C to T, chromosome 6 at 39,464,201 bp
T to C, chromosome 6 at 40,761,035 bp
T to A, chromosome 6 at 41,968,186 bp
A to T, chromosome 6 at 57,113,501 bp
T to C, chromosome 6 at 83,124,091 bp
G to T, chromosome 6 at 126,827,532 bp
T to C, chromosome 6 at 148,249,581 bp
T to A, chromosome 7 at 10,159,466 bp
A to G, chromosome 7 at 12,193,848 bp
G to T, chromosome 7 at 23,430,157 bp
G to T, chromosome 7 at 28,142,274 bp
A to G, chromosome 7 at 29,532,000 bp
G to T, chromosome 7 at 42,195,140 bp
T to A, chromosome 7 at 45,336,497 bp
A to G, chromosome 7 at 75,614,930 bp
C to T, chromosome 7 at 79,407,417 bp
C to G, chromosome 7 at 81,078,610 bp
A to T, chromosome 7 at 101,828,499 bp
T to A, chromosome 8 at 56,590,097 bp
C to T, chromosome 8 at 72,001,012 bp
A to T, chromosome 8 at 112,842,516 bp
A to G, chromosome 8 at 122,865,436 bp
A to G, chromosome 9 at 7,561,454 bp
T to A, chromosome 9 at 18,755,333 bp
T to A, chromosome 9 at 38,109,486 bp
A to C, chromosome 9 at 53,425,671 bp
A to T, chromosome 9 at 62,760,346 bp
A to T, chromosome 9 at 72,972,336 bp
T to C, chromosome 9 at 108,799,233 bp
C to A, chromosome 9 at 110,638,163 bp
G to T, chromosome 9 at 122,888,893 bp
A to T, chromosome 9 at 123,774,552 bp
G to T, chromosome 10 at 7,743,749 bp
G to T, chromosome 10 at 50,748,926 bp
T to A, chromosome 10 at 62,188,093 bp
G to A, chromosome 10 at 86,967,613 bp
T to C, chromosome 10 at 109,767,128 bp
T to A, chromosome 10 at 118,293,185 bp
T to A, chromosome 10 at 129,647,731 bp
G to A, chromosome 10 at 130,074,823 bp
T to C, chromosome 11 at 9,293,810 bp
A to G, chromosome 11 at 77,472,745 bp
A to T, chromosome 11 at 86,346,003 bp
A to T, chromosome 11 at 96,147,556 bp
A to G, chromosome 11 at 98,167,574 bp
G to T, chromosome 11 at 100,746,169 bp
C to A, chromosome 11 at 105,254,973 bp
T to C, chromosome 11 at 117,817,095 bp
T to C, chromosome 12 at 30,015,529 bp
T to C, chromosome 12 at 71,075,830 bp
A to G, chromosome 12 at 103,061,407 bp
G to T, chromosome 12 at 112,913,377 bp
T to C, chromosome 13 at 30,705,658 bp
G to A, chromosome 13 at 74,283,024 bp
T to A, chromosome 13 at 100,148,842 bp
A to G, chromosome 13 at 100,308,213 bp
A to T, chromosome 13 at 102,754,161 bp
G to A, chromosome 13 at 108,373,841 bp
A to G, chromosome 14 at 55,887,968 bp
A to G, chromosome 14 at 75,525,927 bp
CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
A to T, chromosome 15 at 28,299,110 bp
A to G, chromosome 15 at 44,522,738 bp
G to A, chromosome 15 at 58,114,257 bp
A to T, chromosome 15 at 98,908,773 bp
T to A, chromosome 16 at 14,410,927 bp
T to C, chromosome 16 at 22,929,756 bp
T to A, chromosome 16 at 27,406,658 bp
C to T, chromosome 16 at 32,680,590 bp
T to C, chromosome 16 at 43,609,746 bp
G to T, chromosome 17 at 13,885,508 bp
A to T, chromosome 17 at 23,290,943 bp
A to T, chromosome 17 at 32,316,260 bp
T to C, chromosome 17 at 35,873,711 bp
A to C, chromosome 17 at 36,866,986 bp
T to C, chromosome 17 at 47,703,822 bp
A to G, chromosome 17 at 49,463,924 bp
T to C, chromosome 17 at 78,926,124 bp
T to A, chromosome 17 at 87,361,864 bp
A to G, chromosome 18 at 6,440,202 bp
T to G, chromosome 18 at 45,560,518 bp
A to T, chromosome 18 at 89,009,460 bp
C to A, chromosome 19 at 12,461,691 bp
A to G, chromosome 19 at 37,004,534 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R0310 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
038520-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All