Strain Name:
C57BL/6J-MtgxR0310Btlr/Mmmh
Stock Number:
038520-MU
Citation ID:
RRID:MMRRC_038520-MU
Other Names:
R0310 (G1), C57BL/6J-MtgxR0310Btlr
Major Collection:

Gene Information

Tk1
Name: thymidine kinase 1
Synonyms: D530002A18Rik, Tk-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21877
Homologene: 37749
Epha7
Name: Eph receptor A7
Synonyms: Mdk1, Hek11, Cek11, Ehk3, MDK1, Ebk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Med1
Name: mediator complex subunit 1
Synonyms: PBP, CRSP210, Pparbp, DRIP205, TRAP 220, l11Jus15, TRAP220
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: D5Bwg1524e, 2410098H20Rik, Rutbc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 52850
Homologene: 64485
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, PTP-H1, 9530011I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Katna1
Name: katanin p60 (ATPase-containing) subunit A1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 23924
HGNC: HGNC:6216
Homologene: 56014
Tlk2
Name: tousled-like kinase 2 (Arabidopsis)
Synonyms: 4933403M19Rik, PKUalpha, protein kinase U-alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 24086
Homologene: 4993
Epc1
Name: enhancer of polycomb homolog 1
Synonyms: 2400007E14Rik, A930032N02Rik, 5730566F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13831
Homologene: 32627
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 328329
Homologene: 42094
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107182
Homologene: 31978
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, Helic1, B630009I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Akap13
Name: A kinase (PRKA) anchor protein 13
Synonyms: 5830460E08Rik, Ht31, PROTO-LBC, AKAP-Lbc, 1700026G02Rik, 5730522G15Rik, PROTO-LB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Ndufa9
Name: NADH:ubiquinone oxidoreductase subunit A9
Synonyms: 1010001N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66108
HGNC: HGNC:7693
Homologene: 3666
Depdc1b
Name: DEP domain containing 1B
Synonyms: XTP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218581
Homologene: 10157
Afdn
Name: afadin, adherens junction formation factor
Synonyms: Mllt4, 5033403D15Rik, Afadin, I-afadin, S-afadin, AF6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Rttn
Name: rotatin
Synonyms: 4921538A15Rik, C530033I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Inppl1
Name: inositol polyphosphate phosphatase-like 1
Synonyms: SHIP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16332
HGNC: HGNC:6080
Homologene: 1204
Arid4a
Name: AT rich interactive domain 4A (RBP1-like)
Synonyms: A630067N03Rik, Rbbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238247
HGNC: HGNC:9885
Homologene: 11303
Fanci
Name: Fanconi anemia, complementation group I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 208836
Homologene: 49530
Zbtb20
Name: zinc finger and BTB domain containing 20
Synonyms: D16Wsu73e, 1300017A20Rik, Zfp288, A930017C21Rik, 7330412A13Rik, HOF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 56490
Homologene: 9226
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 22772
Homologene: 5171
Lmbr1l
Name: limb region 1 like
Synonyms: D15Ertd735e, 1110013E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74775
Homologene: 10011
Kcnn2
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonyms: bc, fri, SK2, small conductance calcium-activated potassium channel 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 140492
HGNC: HGNC:6291
Homologene: 135651
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Med13
Name: mediator complex subunit 13
Synonyms: 1110067M05Rik, Trap240, Thrap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327987
Homologene: 21067
Dnaaf4
Name: dynein axonemal assembly factor 4
Synonyms: Dyx1c1, 1700010I24Rik, EKN1, b2b811Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67685
Homologene: 12173
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235627
Homologene: 86422
Ddost
Name: dolichyl-di-phosphooligosaccharide-protein glycotransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13200
HGNC: HGNC:2728
Homologene: 3821
Ccdc50
Name: coiled-coil domain containing 50
Synonyms: 2610529H08Rik, 5730448P06Rik, D16Bwg1543e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67501
Homologene: 69406
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 70472
VEGA: 15
Homologene: 6044
Akap8
Name: A kinase (PRKA) anchor protein 8
Synonyms: AKAP95, 1200016A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 56399
VEGA: 17
HGNC: HGNC:378
Homologene: 4278
Nbeal1
Name: neurobeachin like 1
Synonyms: A530083I02Rik, A530050O19Rik, 2310076G13Rik, ALS2CR17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269198
Homologene: 16453
Dennd2a
Name: DENN/MADD domain containing 2A
Synonyms: B930096L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 209773
Homologene: 35238
Tmtc1
Name: transmembrane and tetratricopeptide repeat containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387314
Homologene: 65299
Cyp4f18
Name: cytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms: 1810054N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72054
HGNC: HGNC:2645
Homologene: 128623
Abca13
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268379
Homologene: 27991
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b1154Clo, b2b1537Clo, Dnahc5, b2b3491Clo, b2b1565Clo, Mdnah5, b2b1134Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
4932431P20Rik
Name: RIKEN cDNA 4932431P20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 114675
Olfr888
Name: olfactory receptor 888
Synonyms: GA_x6K02T2PVTD-31787920-31788864, MOR162-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258416
Homologene: 84577
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: PKHDL1, fibrocystin L, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Ahrr
Name: aryl-hydrocarbon receptor repressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 11624
HGNC: HGNC:346
Homologene: 49215
Nav3
Name: neuron navigator 3
Synonyms: unc53H3, 9630020C08Rik, Pomfil1p, steerin 3, 4732483H20Rik, POMFIL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 260315
Homologene: 56688
E130309D02Rik
Name: RIKEN cDNA E130309D02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231868
Homologene: 11445
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip-rs6, Birc1b, Naip2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Stab2
Name: stabilin 2
Synonyms: FEEL-2, STAB-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 192188
Homologene: 23022
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
9530053A07Rik
Name: RIKEN cDNA 9530053A07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 319482
Homologene: 130055
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170571
Homologene: 24912
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 100125586
Homologene: 129753
Kcnh4
Name: potassium voltage-gated channel, subfamily H (eag-related), member 4
Synonyms: BEC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380728
HGNC: HGNC:6253
Homologene: 8180
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Birc1f, Naip-rs4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Trim14
Name: tripartite motif-containing 14
Synonyms: 5830400N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74735
Homologene: 13241
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320558
Homologene: 8604
Unc79
Name: unc-79 homolog
Synonyms: Mlca3, 9030205A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217843
Homologene: 41397
Cgn
Name: cingulin
Synonyms: 6330408J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70737
Homologene: 41394
Fetub
Name: fetuin beta
Synonyms: D17980, 2310011O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 59083
VEGA: 16
HGNC: HGNC:3658
Homologene: 8660
Jag2
Name: jagged 2
Synonyms: D12Ggc2e, Serh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16450
VEGA: 12
HGNC: HGNC:6189
Homologene: 1677
Gne
Name: glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms: 2310066H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 50798
Homologene: 3996
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 69675
Homologene: 33907
Tspan15
Name: tetraspanin 15
Synonyms: Tm4sf15, 2700063A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70423
VEGA: 10
Homologene: 22716
Olfr799
Name: olfactory receptor 799
Synonyms: MOR114-2, GA_x6K02T2PULF-11325750-11326685
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258929
Homologene: 37000
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 116904
Homologene: 10813
Ppp1r18
Name: protein phosphatase 1, regulatory subunit 18
Synonyms: 2310014H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 76448
Homologene: 19512
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: A730013O20Rik, 5730592G18Rik, C130038G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77521
Homologene: 78141
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 666002
Homologene: 86604
Cebpz
Name: CCAAT/enhancer binding protein zeta
Synonyms: Cbf, Cebpa-rs1, CBF2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12607
VEGA: 17
Homologene: 4210
Mpeg1
Name: macrophage expressed gene 1
Synonyms: Mpg-1, MPS1, Perforin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 17476
VEGA: 19
Homologene: 11216
Siah3
Name: siah E3 ubiquitin protein ligase family member 3
Synonyms: LOC380918
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 380918
VEGA: 14
Homologene: 54375
Chil3
Name: chitinase-like 3
Synonyms: Chi3l3, Ym1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12655
Homologene: 74931
Daam2
Name: dishevelled associated activator of morphogenesis 2
Synonyms: 2310016D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 76441
VEGA: 17
Homologene: 69186
Ttc7
Name: tetratricopeptide repeat domain 7
Synonyms: hea, fsn, 1700007L07Rik, 1110035E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 225049
Homologene: 12515
Nr0b2
Name: nuclear receptor subfamily 0, group B, member 2
Synonyms: small heterodimer partner, SHP, SHP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 23957
HGNC: HGNC:7961
Homologene: 8030
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384534
Homologene: 129605
Fbxo8
Name: F-box protein 8
Synonyms: Fbx8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 50753
Homologene: 8137
Sval3
Name: seminal vesicle antigen-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387564
Homologene: 133811
Ppm1l
Name: protein phosphatase 1 (formerly 2C)-like
Synonyms: Pp2ce, 5930404J21Rik, PP2C-epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242083
Homologene: 33158
Ttll6
Name: tubulin tyrosine ligase-like family, member 6
Synonyms: D11Moh44e, D11Moh43e, t8130b59, 4932418K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237930
Homologene: 18229
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: Idh-1, IDPc, E030024J03Rik, Id-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
Rbm12
Name: RNA binding motif protein 12
Synonyms: 9430070C08Rik, 5730420G12Rik, SWAN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Bbs12
Name: Bardet-Biedl syndrome 12 (human)
Synonyms: LOC241950, LOC386537, LOC241950
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 241950
Homologene: 17634
Vmn2r4
Name: vomeronasal 2, receptor 4
Synonyms: EG637053
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 637053
Homologene: 129754
Sprr2k
Name: small proline-rich protein 2K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20765
Slc22a15
Name: solute carrier family 22 (organic anion/cation transporter), member 15
Synonyms: 2610034P21Rik, A530052I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242126
Homologene: 41263
Gm15886
Name: predicted gene 15886
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 102637354
Vcam1
Name: vascular cell adhesion molecule 1
Synonyms: Vcam-1, CD106
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22329
Homologene: 838
Barhl2
Name: BarH like homeobox 2
Synonyms: MBH1, E130309B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 104382
HGNC: HGNC:954
Homologene: 10572
Akr1b8
Name: aldo-keto reductase family 1, member B8
Synonyms: Fgfrp, Fgrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14187
Homologene: 116462
Vmn1r10
Name: vomeronasal 1 receptor 10
Synonyms: V1rc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113858
Homologene: 76459
Ino80b
Name: INO80 complex subunit B
Synonyms: 2510009I23Rik, Hmga1l4, HMG1YL4, Znhit4, Papa1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70020
Homologene: 32566
Vmn1r80
Name: vomeronasal 1 receptor 80
Synonyms: V1rg3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171238
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Nalp5, Mater, Op1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23968
Homologene: 65105
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: EG637898, Casr-rs3, Gprc2a-rs3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 637898
Homologene: 129683
Cdh15
Name: cadherin 15
Synonyms: M cadherin, Cdh14, Mcad
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Olfr24
Name: olfactory receptor 24
Synonyms: MOR132-1, MTPCR51, GA_x6K02T2PVTD-12498544-12497603
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18322
HGNC: HGNC:8220
Homologene: 64896
4930550C14Rik
Name: RIKEN cDNA 4930550C14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75311
VEGA: 9
Homologene: 12595
Ip6k2
Name: inositol hexaphosphate kinase 2
Synonyms: 1500005N04Rik, Ihpk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 76500
Homologene: 56929
Zkscan7
Name: zinc finger with KRAB and SCAN domains 7
Synonyms: Zfp167
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382118
VEGA: 9
Homologene: 83284
Ccr9
Name: chemokine (C-C motif) receptor 9
Synonyms: Cmkbr10, GPR-9-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12769
HGNC: HGNC:1610
Homologene: 22546
Iltifb
Name: interleukin 10-related T cell-derived inducible factor beta
Synonyms: Il22b, IL-TIFb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 116849
Homologene: 9669
Olfr822
Name: olfactory receptor 822
Synonyms: MOR113-2, GA_x6K02T2PULF-11745102-11746040
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258666
Homologene: 133890
Ankrd13b
Name: ankyrin repeat domain 13b
Synonyms: B930093C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268445
Homologene: 27367
Dusp22
Name: dual specificity phosphatase 22
Synonyms: JKAP, JSP1, 1110028K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105352
Homologene: 86039
Khnyn
Name: KH and NYN domain containing
Synonyms: 9130227C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219094
VEGA: 14
Homologene: 23611
Abcc1
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Synonyms: MRP, Mdrap, Mrp1, Abcc1b, Abcc1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: Pyk1, P21cdc42Hs kinase, Ack, activated p21cdc42Hs kinase, ACK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 51789
Homologene: 4224
Trim15
Name: tripartite motif-containing 15
Synonyms: 1810012B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 69097
Homologene: 23819
Frs3
Name: fibroblast growth factor receptor substrate 3
Synonyms: 4930417B13Rik, Frs2beta, SNT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 107971
Homologene: 4845
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 20,549,822 bp
  • T to C, chromosome 1 at 60,305,370 bp
  • T to C, chromosome 1 at 65,161,920 bp
  • T to A, chromosome 2 at 125,363,644 bp
  • A to G, chromosome 2 at 156,095,724 bp
  • C to G, chromosome 2 at 178,381,855 bp
  • G to T, chromosome 2 at 180,181,566 bp
  • T to A, chromosome 3 at 37,321,045 bp
  • A to T, chromosome 3 at 64,134,618 bp
  • A to T, chromosome 3 at 64,389,434 bp
  • A to G, chromosome 3 at 69,549,461 bp
  • A to T, chromosome 3 at 92,433,463 bp
  • C to T, chromosome 3 at 94,765,653 bp
  • G to T, chromosome 3 at 101,860,511 bp
  • T to A, chromosome 3 at 103,777,335 bp
  • T to A, chromosome 3 at 106,160,523 bp
  • A to T, chromosome 3 at 116,114,416 bp
  • A to G, chromosome 4 at 28,961,301 bp
  • C to A, chromosome 4 at 44,060,157 bp
  • C to A, chromosome 4 at 46,522,043 bp
  • A to T, chromosome 4 at 57,204,958 bp
  • C to A, chromosome 4 at 133,555,992 bp
  • T to A, chromosome 4 at 138,310,611 bp
  • G to T, chromosome 5 at 106,457,387 bp
  • G to T, chromosome 5 at 113,263,705 bp
  • G to T, chromosome 5 at 143,307,888 bp
  • T to C, chromosome 5 at 148,107,019 bp
  • T to C, chromosome 6 at 34,365,259 bp
  • C to T, chromosome 6 at 39,464,201 bp
  • T to C, chromosome 6 at 40,761,035 bp
  • T to A, chromosome 6 at 41,968,186 bp
  • A to T, chromosome 6 at 57,113,501 bp
  • T to C, chromosome 6 at 83,124,091 bp
  • G to T, chromosome 6 at 126,827,532 bp
  • T to C, chromosome 6 at 148,249,581 bp
  • T to A, chromosome 7 at 10,159,466 bp
  • A to G, chromosome 7 at 12,193,848 bp
  • G to T, chromosome 7 at 23,430,157 bp
  • G to T, chromosome 7 at 28,142,274 bp
  • A to G, chromosome 7 at 29,532,000 bp
  • G to T, chromosome 7 at 42,195,140 bp
  • T to A, chromosome 7 at 45,336,497 bp
  • A to G, chromosome 7 at 75,614,930 bp
  • C to T, chromosome 7 at 79,407,417 bp
  • C to G, chromosome 7 at 81,078,610 bp
  • A to T, chromosome 7 at 101,828,499 bp
  • T to A, chromosome 8 at 56,590,097 bp
  • C to T, chromosome 8 at 72,001,012 bp
  • A to T, chromosome 8 at 112,842,516 bp
  • A to G, chromosome 8 at 122,865,436 bp
  • A to G, chromosome 9 at 7,561,454 bp
  • T to A, chromosome 9 at 18,755,333 bp
  • T to A, chromosome 9 at 38,109,486 bp
  • A to C, chromosome 9 at 53,425,671 bp
  • A to T, chromosome 9 at 62,760,346 bp
  • A to T, chromosome 9 at 72,972,336 bp
  • T to C, chromosome 9 at 108,799,233 bp
  • C to A, chromosome 9 at 110,638,163 bp
  • G to T, chromosome 9 at 122,888,893 bp
  • A to T, chromosome 9 at 123,774,552 bp
  • G to T, chromosome 10 at 7,743,749 bp
  • G to T, chromosome 10 at 50,748,926 bp
  • T to A, chromosome 10 at 62,188,093 bp
  • G to A, chromosome 10 at 86,967,613 bp
  • T to C, chromosome 10 at 109,767,128 bp
  • T to A, chromosome 10 at 118,293,185 bp
  • T to A, chromosome 10 at 129,647,731 bp
  • G to A, chromosome 10 at 130,074,823 bp
  • T to C, chromosome 11 at 9,293,810 bp
  • A to G, chromosome 11 at 77,472,745 bp
  • A to T, chromosome 11 at 86,346,003 bp
  • A to T, chromosome 11 at 96,147,556 bp
  • A to G, chromosome 11 at 98,167,574 bp
  • G to T, chromosome 11 at 100,746,169 bp
  • C to A, chromosome 11 at 105,254,973 bp
  • T to C, chromosome 11 at 117,817,095 bp
  • T to C, chromosome 12 at 30,015,529 bp
  • T to C, chromosome 12 at 71,075,830 bp
  • A to G, chromosome 12 at 103,061,407 bp
  • G to T, chromosome 12 at 112,913,377 bp
  • T to C, chromosome 13 at 30,705,658 bp
  • G to A, chromosome 13 at 74,283,024 bp
  • T to A, chromosome 13 at 100,148,842 bp
  • A to G, chromosome 13 at 100,308,213 bp
  • A to T, chromosome 13 at 102,754,161 bp
  • G to A, chromosome 13 at 108,373,841 bp
  • A to G, chromosome 14 at 55,887,968 bp
  • A to G, chromosome 14 at 75,525,927 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • A to T, chromosome 15 at 28,299,110 bp
  • A to G, chromosome 15 at 44,522,738 bp
  • G to A, chromosome 15 at 58,114,257 bp
  • A to T, chromosome 15 at 98,908,773 bp
  • T to A, chromosome 16 at 14,410,927 bp
  • T to C, chromosome 16 at 22,929,756 bp
  • T to A, chromosome 16 at 27,406,658 bp
  • C to T, chromosome 16 at 32,680,590 bp
  • T to C, chromosome 16 at 43,609,746 bp
  • G to T, chromosome 17 at 13,885,508 bp
  • A to T, chromosome 17 at 23,290,943 bp
  • A to T, chromosome 17 at 32,316,260 bp
  • T to C, chromosome 17 at 35,873,711 bp
  • A to C, chromosome 17 at 36,866,986 bp
  • T to C, chromosome 17 at 47,703,822 bp
  • A to G, chromosome 17 at 49,463,924 bp
  • T to C, chromosome 17 at 78,926,124 bp
  • T to A, chromosome 17 at 87,361,864 bp
  • A to G, chromosome 18 at 6,440,202 bp
  • T to G, chromosome 18 at 45,560,518 bp
  • A to T, chromosome 18 at 89,009,460 bp
  • C to A, chromosome 19 at 12,461,691 bp
  • A to G, chromosome 19 at 37,004,534 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0310 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
038520-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.