Strain Name:
Stock Number:
Citation ID:
Other Names:
R0415 (G1), C57BL/6J-MtgxR0415Btlr
Major Collection:

Strain Information

Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20742
Homologene: 2354
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
Homologene: 61
Name: 5-hydroxytryptamine (serotonin) receptor 6
Synonyms: 5-HT6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15565
Homologene: 673
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22064
Homologene: 135989
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Name: ring finger protein 145
Synonyms: 3732413I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74315
Homologene: 14427
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 208440
Homologene: 40996
Name: tubulin folding cofactor E-like
Synonyms: E130107N23Rik, Lrrc35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 272589
Homologene: 16120
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72313
Homologene: 103956
Name: gametogenetin binding protein 2
Synonyms: DIF-3, Zfp403, D330017P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217039
Homologene: 11750
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kv3.4, Kcr2-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99738
Homologene: 68427
Name: RAD51 paralog C
Synonyms: Rad51l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 114714
Homologene: 14238
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93742
Homologene: 10489
Name: splicing factor SWAP
Synonyms: 6330437E22Rik, 1190005N23Rik, Sfrs8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231769
Homologene: 134548
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18844
Homologene: 56426
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70699
Homologene: 45971
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, D9Ertd809e, Dopey1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320615
Homologene: 26645
Name: activating transcription factor 7 interacting protein
Synonyms: ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54343
Homologene: 10051
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233789
Homologene: 56697
Name: anaphase promoting complex subunit 2
Synonyms: expressed during mesenchymal induction 4, Emi4, APC2, 9230107K09Rik, Imi4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99152
Homologene: 8359
Name: DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms: 2810028N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 72662
VEGA: 14
Homologene: 6910
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Name: transmembrane protein 43
Synonyms: 1200015A22Rik, LUMA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74122
Homologene: 11532
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms: 3830408D16Rik, D4Ertd321e, Af9, 2210011H10Rik, 2610012I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70122
Homologene: 37933
Name: cullin 5
Synonyms: 4921514I20Rik, C330021I08Rik, C030032G03Rik, VACM-1, 8430423K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75717
Homologene: 2597
Name: eukaryotic translation initiation factor 3, subunit D
Synonyms: mouse translation initiation factor eIF3 p66, eIF3p66, 66/67kDa, Eif3s7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 55944
VEGA: 15
Homologene: 2782
Name: ethanolamine kinase 1
Synonyms: 1110061E11Rik, EKI1, 4930555L11Rik, D6Ertd3e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75320
Homologene: 10240
Name: mono-ADP ribosylhydrolase 2
Synonyms: 2610107G07Rik, 1110033L15Rik, 2900006F19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72899
Homologene: 85987
Name: ring finger protein 167
Synonyms: 0610010G05Rik, 5730408C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70510
Homologene: 41046
Name: cystatin 9
Synonyms: testatin, M12, cresp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13013
Homologene: 49222
Name: chemokine (C-X-C motif) ligand 16
Synonyms: SR-PSOX, 0910001K24Rik, SR-PSOX/CXCL16, Scavenger Receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66102
Homologene: 49694
Name: neurexophilin and PC-esterase domain family, member 2
Synonyms: 4432416J03Rik, Fam55b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78252
Homologene: 87072
Name: adhesion G protein-coupled receptor A3
Synonyms: 3830613O22Rik, Tem5-like, Gpr125
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70693
Homologene: 19235
Name: olfactory receptor family 51 subfamily E member 2
Synonyms: RA1c, PSGR, MOL2.3, 4633402A21Rik, MOR18-2, GA_x6K02T2PBJ9-5459657-5458695, Olfr78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 170639
Homologene: 23713
Name: mutS homolog 3
Synonyms: Rep-3, D13Em1, Rep3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17686
Homologene: 1829
Name: selenoprotein F
Synonyms: Sep15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 93684
Homologene: 3145
Name: DnaJ heat shock protein family (Hsp40) member C16
Synonyms: 2900037O03Rik, 4732437J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 214063
Homologene: 45414
Name: zinc finger protein 345
Synonyms: OTTMUSG00000015743
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545471
Homologene: 134546
Name: serine protease inhibitor, Kunitz type 1
Synonyms: HAI-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20732
Homologene: 9653
Name: calcium/calmodulin-dependent protein kinase I
Synonyms: D6Ertd263e, CaMKIalpha, Camk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52163
Homologene: 117458
Name: phospholipase C, delta 4
Synonyms: 4921507K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18802
Homologene: 88782
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 672511
Homologene: 45439
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 619697
Homologene: 86604
Name: zinc finger protein 282
Synonyms: HUB1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101095
Homologene: 2647
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Name: proprotein convertase subtilisin/kexin type 6
Synonyms: PACE4, SPC4, b2b2830Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18553
Homologene: 20569
Name: immunoglobulin heavy constant gamma 2C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 404711
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235505
Homologene: 25183
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
Homologene: 67425
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239556
Homologene: 69331
Name: taste receptor, type 2, member 123
Synonyms: T2R23, Tas2r23, STC 9-2, mGR23, mt2r55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 353167
Homologene: 45450
Name: adhesion G protein-coupled receptor E4
Synonyms: EGF-TM7, D17Ertd479e, FIRE, Gpr127, Emr4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 52614
VEGA: 17
Homologene: 64640
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215772
Homologene: 100289
Name: thrombospondin 2
Synonyms: TSP2, Thbs-2, Thrombospondin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21826
VEGA: 17
Homologene: 2438
Name: vomeronasal 1 receptor 22
Synonyms: V1rc23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171196
Homologene: 110825
Name: MICAL C-terminal like
Synonyms: 4921517J23Rik, Ebitein1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100504195
Homologene: 13149
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68553
Homologene: 130754
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Name: transmembrane protein 132C
Synonyms: 4632425D07Rik, 2810482M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208213
Homologene: 76567
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546980
Homologene: 115466
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237711
Homologene: 104282
Name: transmembrane protein 247
Synonyms: 1700090G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78469
Homologene: 54379
Name: solute carrier family 25, member 34
Synonyms: LOC384071
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 384071
Homologene: 68806
Name: coiled-coil domain containing 40
Synonyms: B930008I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207607
Homologene: 27890
Name: cilia and flagella associated protein 57
Synonyms: C130004B06Rik, LOC384050, 1110020C03Rik, Wdr65
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68625
Homologene: 51350
Name: guanylate binding protein 4
Synonyms: Mag-2, Mpa-2, Mpa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17472
Homologene: 128731
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms: P-REX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 277360
Homologene: 10821
Name: inter-alpha trypsin inhibitor, heavy chain 2
Synonyms: Intin2, Itih-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16425
Homologene: 1668
Name: transmembrane protease, serine 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214531
Homologene: 12936
Name: lymphocyte cytosolic protein 1
Synonyms: L-fimbrin, Pls2, D14Ertd310e, L-plastin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 18826
Homologene: 80174
Name: parathyroid hormone 2 receptor
Synonyms: Pthr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213527
Homologene: 3701
Name: DNA segment, Chr 6, ERATO Doi 527, expressed
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52372
Name: muscle glycogen phosphorylase
Synonyms: PG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19309
Homologene: 2145
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76484
Homologene: 45138
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Name: sulfotransferase family, cytosolic, 2B, member 1
Synonyms: SULT2B, Gm5897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 54200
Homologene: 49487
Name: HECT domain E3 ubiquitin protein ligase 2
Synonyms: A630025O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226098
Homologene: 6280
Name: paired box 5
Synonyms: Pax-5, EBB-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18507
Homologene: 56419
Name: solute carrier family 34 (sodium phosphate), member 3
Synonyms: NPTIIc, Npt2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 142681
Homologene: 15444
Name: olfactory receptor family 5 subfamily M member 10
Synonyms: GA_x6K02T2Q125-47363965-47364900, MOR196-3, Olfr1023
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258580
Homologene: 128087
Name: olfactory receptor family 5 subfamily M member 9
Synonyms: GA_x6K02T2Q125-47521463-47522395, MOR227-8P, MOR227-8P, MOR245-14P, Olfr1533-ps1, Olfr1034
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258216
Homologene: 51741
Name: selenium binding protein 1
Synonyms: Lp56, Lpsb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20341
Homologene: 2930
Name: glutathione S-transferase, mu 2
Synonyms: Gstb-2, Gstb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14863
Homologene: 121492
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 2
Synonyms: F5, I2rf5, I2rf5, Kcnb3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16498
Homologene: 56492
Name: RIKEN cDNA 4933427G23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330053
Name: leucine rich repeat containing 8D
Synonyms: 4930525N13Rik, Lrrc5, 2810473G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231549
Homologene: 10004
Name: zinc finger protein 316
Synonyms: Emzf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54201
Homologene: 69231
Name: olfactory receptor family 8 subfamily C member 15
Synonyms: GA_x6K02T2PVTD-31889215-31890153, MOR170-11, Olfr893
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258333
Homologene: 133626
Name: olfactory receptor family 8 subfamily G member 2
Synonyms: GA_x6K02T02EEW-227-373, GA_x6K02T2PVTD-33608180-33608971, MOR171-14, Olfr973, Olfr229
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258606
Homologene: 115513
Name: PIF1 5'-to-3' DNA helicase
Synonyms: AI449441
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208084
Homologene: 99775
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Name: PQ loop repeat containing
Synonyms: E030024M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217430
Homologene: 16454
Name: transmembrane protein 251
Synonyms: D230037D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320351
VEGA: 12
Homologene: 100948
Name: vomeronasal 1 receptor 196
Synonyms: V1rh19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100312484
Homologene: 110880
Name: acyl-Coenzyme A oxidase 2, branched chain
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 93732
Homologene: 74473
Name: potassium channel, subfamily K, member 16
Synonyms: TALK-1, TALK1, 4731413G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74571
VEGA: 14
Homologene: 75328
Name: polymerase (RNA) II (DNA directed) polypeptide K
Synonyms: MafY, ABC10-alpha, RPB10alpha, RPB7.0, RPABC4, RPB12, Mt1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17749
Homologene: 86049
Name: cytochrome P450, family 2, subfamily c, polypeptide 29
Synonyms: AHOH, AHOHase, P450-2C, Ahh-1, Ah-2, Cyp2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13095
Homologene: 117948
Name: hyaluronic acid binding protein 2
Synonyms: FSAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226243
Homologene: 3050
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 65,388,439 bp
  • C to A, chromosome 1 at 74,552,097 bp
  • G to T, chromosome 1 at 143,760,075 bp
  • A to G, chromosome 2 at 10,105,615 bp
  • T to G, chromosome 2 at 25,229,110 bp
  • A to G, chromosome 2 at 25,278,325 bp
  • A to T, chromosome 2 at 85,887,438 bp
  • A to T, chromosome 2 at 86,047,055 bp
  • A to G, chromosome 2 at 119,245,615 bp
  • A to G, chromosome 2 at 135,337,499 bp
  • G to A, chromosome 2 at 142,210,145 bp
  • T to A, chromosome 2 at 148,838,442 bp
  • A to G, chromosome 2 at 150,474,559 bp
  • A to G, chromosome 2 at 166,586,699 bp
  • T to C, chromosome 3 at 94,936,913 bp
  • T to C, chromosome 3 at 107,445,433 bp
  • T to A, chromosome 3 at 107,984,006 bp
  • T to G, chromosome 3 at 144,577,692 bp
  • G to A, chromosome 4 at 44,691,886 bp
  • ACTGCTGCTGCTGCTGCTGCT to ACTGCTGCTGCTGCTGCT, chromosome 4 at 87,841,339 bp
  • A to T, chromosome 4 at 118,569,431 bp
  • A to G, chromosome 4 at 139,062,081 bp
  • C to A, chromosome 4 at 141,620,469 bp
  • A to T, chromosome 4 at 141,789,048 bp
  • A to G, chromosome 4 at 152,395,136 bp
  • A to T, chromosome 5 at 23,831,050 bp
  • C to A, chromosome 5 at 49,961,757 bp
  • T to C, chromosome 5 at 73,098,414 bp
  • G to A, chromosome 5 at 105,121,106 bp
  • T to C, chromosome 5 at 105,811,865 bp
  • A to G, chromosome 5 at 127,563,705 bp
  • A to T, chromosome 5 at 129,504,126 bp
  • T to A, chromosome 5 at 143,264,491 bp
  • T to C, chromosome 6 at 35,214,634 bp
  • A to G, chromosome 6 at 47,897,881 bp
  • T to A, chromosome 6 at 47,905,053 bp
  • G to T, chromosome 6 at 57,900,332 bp
  • C to G, chromosome 6 at 87,111,524 bp
  • G to A, chromosome 6 at 89,357,336 bp
  • C to A, chromosome 6 at 91,482,318 bp
  • A to T, chromosome 6 at 113,341,891 bp
  • A to T, chromosome 6 at 132,847,838 bp
  • C to T, chromosome 6 at 136,560,012 bp
  • A to G, chromosome 6 at 143,180,774 bp
  • A to G, chromosome 7 at 45,730,092 bp
  • C to T, chromosome 7 at 66,033,874 bp
  • A to C, chromosome 7 at 85,961,410 bp
  • T to C, chromosome 7 at 102,080,616 bp
  • C to T, chromosome 7 at 102,742,087 bp
  • C to T, chromosome 7 at 112,381,028 bp
  • C to A, chromosome 7 at 118,182,468 bp
  • C to T, chromosome 7 at 139,930,124 bp
  • G to A, chromosome 8 at 127,610,566 bp
  • A to T, chromosome 9 at 38,209,973 bp
  • A to G, chromosome 9 at 39,909,983 bp
  • C to A, chromosome 9 at 42,444,500 bp
  • A to G, chromosome 9 at 45,337,132 bp
  • T to C, chromosome 9 at 48,326,614 bp
  • C to T, chromosome 9 at 53,667,070 bp
  • G to A, chromosome 9 at 65,588,051 bp
  • T to A, chromosome 9 at 78,712,615 bp
  • T to A, chromosome 9 at 86,506,502 bp
  • C to T, chromosome 9 at 106,075,080 bp
  • T to C, chromosome 10 at 10,431,067 bp
  • A to G, chromosome 10 at 18,613,127 bp
  • A to G, chromosome 10 at 77,788,173 bp
  • A to G, chromosome 11 at 29,749,392 bp
  • A to C, chromosome 11 at 30,149,576 bp
  • A to G, chromosome 11 at 44,525,138 bp
  • T to A, chromosome 11 at 70,458,748 bp
  • T to C, chromosome 11 at 70,649,699 bp
  • A to C, chromosome 11 at 84,833,225 bp
  • A to G, chromosome 11 at 87,397,655 bp
  • T to C, chromosome 11 at 119,232,118 bp
  • A to T, chromosome 11 at 119,414,469 bp
  • C to A, chromosome 12 at 16,997,710 bp
  • T to A, chromosome 12 at 102,744,876 bp
  • T to C, chromosome 12 at 113,287,910 bp
  • C to T, chromosome 13 at 9,568,289 bp
  • T to C, chromosome 13 at 11,869,156 bp
  • T to C, chromosome 13 at 13,711,610 bp
  • T to A, chromosome 13 at 22,293,836 bp
  • A to G, chromosome 13 at 92,346,786 bp
  • A to G, chromosome 14 at 8,243,835 bp
  • T to A, chromosome 14 at 20,262,975 bp
  • A to T, chromosome 14 at 75,227,006 bp
  • A to T, chromosome 14 at 99,087,456 bp
  • A to G, chromosome 15 at 36,175,456 bp
  • T to C, chromosome 15 at 37,972,980 bp
  • A to G, chromosome 15 at 77,966,223 bp
  • A to G, chromosome 15 at 80,368,830 bp
  • A to C, chromosome 17 at 14,679,973 bp
  • G to A, chromosome 17 at 23,387,279 bp
  • G to A, chromosome 17 at 55,852,288 bp
  • G to T, chromosome 17 at 86,922,322 bp
  • A to G, chromosome 19 at 6,391,366 bp
  • A to G, chromosome 19 at 9,012,871 bp
  • T to C, chromosome 19 at 36,584,884 bp
  • T to C, chromosome 19 at 39,329,095 bp
  • T to C, chromosome 19 at 56,317,717 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0415 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038617-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.