Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0415Btlr/Mmmh
Stock Number:
038617-MU
Citation ID:
RRID:MMRRC_038617-MU
Other Names:
R0415 (G1), C57BL/6J-MtgxR0415Btlr
Major Collection:

Strain Information

Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Htr6
Name: 5-hydroxytryptamine (serotonin) receptor 6
Synonyms: 5-HT6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15565
HGNC: HGNC:5301
Homologene: 673
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22064
Homologene: 135989
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Rnf145
Name: ring finger protein 145
Synonyms: 3732413I11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74315
Homologene: 14427
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 65,388,439 bp
  • C to A, chromosome 1 at 74,552,097 bp
  • G to T, chromosome 1 at 143,760,075 bp
  • A to G, chromosome 2 at 10,105,615 bp
  • T to G, chromosome 2 at 25,229,110 bp
  • A to G, chromosome 2 at 25,278,325 bp
  • A to T, chromosome 2 at 85,887,438 bp
  • A to T, chromosome 2 at 86,047,055 bp
  • A to G, chromosome 2 at 119,245,615 bp
  • A to G, chromosome 2 at 135,337,499 bp
  • G to A, chromosome 2 at 142,210,145 bp
  • T to A, chromosome 2 at 148,838,442 bp
  • A to G, chromosome 2 at 150,474,559 bp
  • A to G, chromosome 2 at 166,586,699 bp
  • T to C, chromosome 3 at 94,936,913 bp
  • T to C, chromosome 3 at 107,445,433 bp
  • T to A, chromosome 3 at 107,984,006 bp
  • T to G, chromosome 3 at 144,577,692 bp
  • G to A, chromosome 4 at 44,691,886 bp
  • ACTGCTGCTGCTGCTGCTGCT to ACTGCTGCTGCTGCTGCT, chromosome 4 at 87,841,339 bp
  • A to T, chromosome 4 at 118,569,431 bp
  • A to G, chromosome 4 at 139,062,081 bp
  • C to A, chromosome 4 at 141,620,469 bp
  • A to T, chromosome 4 at 141,789,048 bp
  • A to G, chromosome 4 at 152,395,136 bp
  • A to T, chromosome 5 at 23,831,050 bp
  • C to A, chromosome 5 at 49,961,757 bp
  • T to C, chromosome 5 at 73,098,414 bp
  • G to A, chromosome 5 at 105,121,106 bp
  • T to C, chromosome 5 at 105,811,865 bp
  • A to G, chromosome 5 at 127,563,705 bp
  • A to T, chromosome 5 at 129,504,126 bp
  • T to A, chromosome 5 at 143,264,491 bp
  • T to C, chromosome 6 at 35,214,634 bp
  • A to G, chromosome 6 at 47,897,881 bp
  • T to A, chromosome 6 at 47,905,053 bp
  • G to T, chromosome 6 at 57,900,332 bp
  • C to G, chromosome 6 at 87,111,524 bp
  • G to A, chromosome 6 at 89,357,336 bp
  • C to A, chromosome 6 at 91,482,318 bp
  • A to T, chromosome 6 at 113,341,891 bp
  • A to T, chromosome 6 at 132,847,838 bp
  • C to T, chromosome 6 at 136,560,012 bp
  • A to G, chromosome 6 at 143,180,774 bp
  • A to G, chromosome 7 at 45,730,092 bp
  • C to T, chromosome 7 at 66,033,874 bp
  • A to C, chromosome 7 at 85,961,410 bp
  • T to C, chromosome 7 at 102,080,616 bp
  • C to T, chromosome 7 at 102,742,087 bp
  • C to T, chromosome 7 at 112,381,028 bp
  • C to A, chromosome 7 at 118,182,468 bp
  • C to T, chromosome 7 at 139,930,124 bp
  • G to A, chromosome 8 at 127,610,566 bp
  • A to T, chromosome 9 at 38,209,973 bp
  • A to G, chromosome 9 at 39,909,983 bp
  • C to A, chromosome 9 at 42,444,500 bp
  • A to G, chromosome 9 at 45,337,132 bp
  • T to C, chromosome 9 at 48,326,614 bp
  • C to T, chromosome 9 at 53,667,070 bp
  • G to A, chromosome 9 at 65,588,051 bp
  • T to A, chromosome 9 at 78,712,615 bp
  • T to A, chromosome 9 at 86,506,502 bp
  • C to T, chromosome 9 at 106,075,080 bp
  • T to C, chromosome 10 at 10,431,067 bp
  • A to G, chromosome 10 at 18,613,127 bp
  • A to G, chromosome 10 at 77,788,173 bp
  • A to G, chromosome 11 at 29,749,392 bp
  • A to C, chromosome 11 at 30,149,576 bp
  • A to G, chromosome 11 at 44,525,138 bp
  • T to A, chromosome 11 at 70,458,748 bp
  • T to C, chromosome 11 at 70,649,699 bp
  • A to C, chromosome 11 at 84,833,225 bp
  • A to G, chromosome 11 at 87,397,655 bp
  • T to C, chromosome 11 at 119,232,118 bp
  • A to T, chromosome 11 at 119,414,469 bp
  • C to A, chromosome 12 at 16,997,710 bp
  • T to A, chromosome 12 at 102,744,876 bp
  • T to C, chromosome 12 at 113,287,910 bp
  • C to T, chromosome 13 at 9,568,289 bp
  • T to C, chromosome 13 at 11,869,156 bp
  • T to C, chromosome 13 at 13,711,610 bp
  • T to A, chromosome 13 at 22,293,836 bp
  • A to G, chromosome 13 at 92,346,786 bp
  • A to G, chromosome 14 at 8,243,835 bp
  • T to A, chromosome 14 at 20,262,975 bp
  • A to T, chromosome 14 at 75,227,006 bp
  • A to T, chromosome 14 at 99,087,456 bp
  • A to G, chromosome 15 at 36,175,456 bp
  • T to C, chromosome 15 at 37,972,980 bp
  • A to G, chromosome 15 at 77,966,223 bp
  • A to G, chromosome 15 at 80,368,830 bp
  • A to C, chromosome 17 at 14,679,973 bp
  • G to A, chromosome 17 at 23,387,279 bp
  • G to A, chromosome 17 at 55,852,288 bp
  • G to T, chromosome 17 at 86,922,322 bp
  • A to G, chromosome 19 at 6,391,366 bp
  • A to G, chromosome 19 at 9,012,871 bp
  • T to C, chromosome 19 at 36,584,884 bp
  • T to C, chromosome 19 at 39,329,095 bp
  • T to C, chromosome 19 at 56,317,717 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0415 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038617-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.