Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0418Btlr/Mmmh
Stock Number:
038620-MU
Citation ID:
RRID:MMRRC_038620-MU
Other Names:
R0418 (G1), C57BL/6J-MtgxR0418Btlr
Major Collection:

Strain Information

Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Irx3
Name: Iroquois related homeobox 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16373
Homologene: 7385
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Mapk14
Name: mitogen-activated protein kinase 14
Synonyms: p38-alpha, p38, p38 MAP Kinase, Mxi2, CSBP2, Crk1, Csbp1, p38MAPK, p38a, p38 alpha, p38alpha, p38 MAP kinase alpha, p38 MAPK
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26416
HGNC: HGNC:6876
Homologene: 31777
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Katnb1
Name: katanin p80 (WD40-containing) subunit B 1
Synonyms: KAT, 2410003J24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74187
HGNC: HGNC:6217
Homologene: 4302
Nr2c1
Name: nuclear receptor subfamily 2, group C, member 1
Synonyms: TR2, Tr2-11, 4831444H07Rik, Eenr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22025
HGNC: HGNC:7971
Homologene: 55731
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Rassf3
Name: Ras association (RalGDS/AF-6) domain family member 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192678
VEGA: 10
Homologene: 16365
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22772
Homologene: 5171
Rnf126
Name: ring finger protein 126
Synonyms: 2610010O19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70294
VEGA: 10
Homologene: 27024
Spag9
Name: sperm associated antigen 9
Synonyms: 4733401I23Rik, syd1, 4831406C20Rik, Mapk8ip4, JIP4, 3110018C07Rik, JLP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70834
Homologene: 2954
Tpbg
Name: trophoblast glycoprotein
Synonyms: 5T4, 5T4 oncofetal antigen
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21983
Homologene: 4859
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Glb1l2
Name: galactosidase, beta 1-like 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244757
Homologene: 71790
Fam13c
Name: family with sequence similarity 13, member C
Synonyms: C030038O19Rik, 1200015N20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71721
Homologene: 11490
Usp37
Name: ubiquitin specific peptidase 37
Synonyms: 4932415L06Rik, C330008N13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319651
Homologene: 10858
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: DPRP2, 6430584G11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Aldh1a1
Name: aldehyde dehydrogenase family 1, subfamily A1
Synonyms: ALDH1, E1, Ahd-2, Ahd2, Raldh1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11668
HGNC: HGNC:402
Homologene: 110441
Nobox
Name: NOBOX oogenesis homeobox
Synonyms: Og2x
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18291
Homologene: 51066
Fli1
Name: Friend leukemia integration 1
Synonyms: Sic1, SIC-1, EWSR2, Fli-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14247
HGNC: HGNC:3749
Homologene: 55624
Tnik
Name: TRAF2 and NCK interacting kinase
Synonyms: 4831440I19Rik, 1500031A17Rik, C530008O15Rik, C630040K21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 665113
Homologene: 77943
Myo16
Name: myosin XVI
Synonyms: C230040D10Rik, Nyap3, BM140241
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244281
Homologene: 34710
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Vwa7
Name: von Willebrand factor A domain containing 7
Synonyms: G7c, D17H6S56E-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27762
Homologene: 11895
Slc5a8
Name: solute carrier family 5 (iodide transporter), member 8
Synonyms: SMCT
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216225
VEGA: 10
Homologene: 64832
Pdzd8
Name: PDZ domain containing 8
Synonyms: A630041P07Rik, Pdzk8
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Slc16a10
Name: solute carrier family 16 (monocarboxylic acid transporters), member 10
Synonyms: PRO0813, TAT1, 2610103N14Rik, Mct10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72472
VEGA: 10
Homologene: 75089
Acss3
Name: acyl-CoA synthetase short-chain family member 3
Synonyms: LOC380660, 8430416H19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380660
Homologene: 11587
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 1110004O12Rik, 9130019P20Rik, 4933432B13Rik, A530027J04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108857
Homologene: 87006
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Tmem266
Name: transmembrane protein 266
Synonyms: AI118078
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244886
Homologene: 17551
Igsf3
Name: immunoglobulin superfamily, member 3
Synonyms: 4833439O17Rik, 2810035F16Rik, 1700016K10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78908
HGNC: HGNC:5950
Homologene: 1182
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621430
Homologene: 115466
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Tmprss11f
Name: transmembrane protease, serine 11f
Synonyms: 4732406D01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243083
Homologene: 65356
Fbxo17
Name: F-box protein 17
Synonyms: Fbx17, FBXO26, Fbg4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50760
Homologene: 17523
Lrrc31
Name: leucine rich repeat containing 31
Synonyms: E230002P03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320352
Veph1
Name: ventricular zone expressed PH domain-containing 1
Synonyms: Veph, 2810471M23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72789
Homologene: 11624
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384221
Homologene: 104825
Or10ak16
Name: olfactory receptor family 10 subfamily AK member 16
Synonyms: GA_x6K02T2QD9B-18644371-18643424, MOR259-8, Olfr1330
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258331
Homologene: 121524
Suox
Name: sulfite oxidase
Synonyms: SO
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211389
VEGA: 10
Homologene: 394
Ak8
Name: adenylate kinase 8
Synonyms: 1190002A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68870
Homologene: 17622
A930018P22Rik
Name: RIKEN cDNA A930018P22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68243
Homologene: 41690
Abcb1a
Name: ATP-binding cassette, sub-family B member 1A
Synonyms: mdr-3, Mdr1a, P-gp, P-glycoprotein, Pgy-3, Pgy3, multiple drug resistant 1a, MDR3, Pgp, Evi32
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18671
HGNC: HGNC:40
Homologene: 55496
Vstm2b
Name: V-set and transmembrane domain containing 2B
Synonyms: 2900093B09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 58188
Homologene: 10970
Atf5
Name: activating transcription factor 5
Synonyms: AFTA, Atf7, Atfx, ODA-10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 107503
HGNC: HGNC:790
Homologene: 32142
Det1
Name: DET1 partner of COP1 E3 ubiquitin ligase
Synonyms: 2610034H20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76375
Homologene: 9952
Or51a10
Name: olfactory receptor family 51 subfamily A member 10
Synonyms: GA_x6K02T2PBJ9-6784380-6783436, MOR13-6, Olfr642
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258326
Homologene: 17196
Slc36a4
Name: solute carrier family 36 (proton/amino acid symporter), member 4
Synonyms: PAT4, 6330573I15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234967
Homologene: 56300
Rmnd1
Name: required for meiotic nuclear division 1 homolog
Synonyms: 0610042C05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66084
Homologene: 5675
Mtif2
Name: mitochondrial translational initiation factor 2
Synonyms: IF-2mt, 2410112O06Rik, 2310038D14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76784
HGNC: HGNC:7441
Homologene: 1840
Rnf144b
Name: ring finger protein 144B
Synonyms: E130105P19Rik, Ibrdc2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218215
VEGA: 13
Homologene: 27092
Zfp647
Name: zinc finger protein 647
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239546
VEGA: 15
Homologene: 27805
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,326,502 bp
  • A to T, chromosome 1 at 74,490,107 bp
  • G to A, chromosome 1 at 118,840,490 bp
  • A to G, chromosome 1 at 132,611,595 bp
  • C to A, chromosome 1 at 158,716,990 bp
  • C to T, chromosome 1 at 161,834,850 bp
  • T to G, chromosome 2 at 28,733,856 bp
  • G to T, chromosome 2 at 104,123,330 bp
  • T to A, chromosome 3 at 28,570,880 bp
  • A to T, chromosome 3 at 30,689,234 bp
  • T to A, chromosome 3 at 66,255,028 bp
  • C to A, chromosome 3 at 101,435,435 bp
  • C to T, chromosome 4 at 118,893,251 bp
  • A to G, chromosome 4 at 129,223,684 bp
  • T to A, chromosome 5 at 8,713,281 bp
  • A to T, chromosome 5 at 86,557,011 bp
  • C to T, chromosome 5 at 109,452,881 bp
  • T to C, chromosome 6 at 43,307,235 bp
  • A to G, chromosome 6 at 90,569,893 bp
  • A to G, chromosome 7 at 28,733,491 bp
  • A to G, chromosome 7 at 40,902,452 bp
  • A to G, chromosome 7 at 44,813,397 bp
  • T to C, chromosome 7 at 78,844,017 bp
  • A to C, chromosome 7 at 87,002,403 bp
  • G to A, chromosome 7 at 104,049,772 bp
  • T to C, chromosome 7 at 120,207,434 bp
  • A to G, chromosome 8 at 10,569,918 bp
  • G to A, chromosome 8 at 91,800,080 bp
  • C to T, chromosome 8 at 95,095,658 bp
  • A to T, chromosome 9 at 15,734,266 bp
  • A to T, chromosome 9 at 16,246,896 bp
  • T to G, chromosome 9 at 26,794,101 bp
  • T to C, chromosome 9 at 32,452,129 bp
  • T to A, chromosome 9 at 55,437,413 bp
  • C to A, chromosome 9 at 85,844,750 bp
  • T to C, chromosome 10 at 4,427,693 bp
  • G to T, chromosome 10 at 40,040,631 bp
  • G to T, chromosome 10 at 50,748,926 bp
  • A to G, chromosome 10 at 70,534,761 bp
  • C to T, chromosome 10 at 79,762,643 bp
  • A to G, chromosome 10 at 88,886,558 bp
  • A to T, chromosome 10 at 94,181,512 bp
  • T to C, chromosome 10 at 107,023,912 bp
  • G to A, chromosome 10 at 121,417,170 bp
  • G to A, chromosome 10 at 128,670,885 bp
  • A to G, chromosome 11 at 29,533,401 bp
  • T to C, chromosome 11 at 94,091,753 bp
  • T to G, chromosome 11 at 103,503,438 bp
  • A to G, chromosome 13 at 11,834,095 bp
  • T to C, chromosome 13 at 47,244,490 bp
  • T to A, chromosome 14 at 103,603,254 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • C to T, chromosome 15 at 76,298,487 bp
  • A to T, chromosome 15 at 76,911,386 bp
  • T to C, chromosome 15 at 80,913,323 bp
  • T to C, chromosome 17 at 28,691,789 bp
  • G to T, chromosome 17 at 35,017,957 bp
  • C to T, chromosome 17 at 56,194,404 bp
  • T to A, chromosome 18 at 36,634,300 bp
  • T to C, chromosome 19 at 20,629,049 bp
  • A to G, chromosome 19 at 55,272,806 bp
  • G to A, chromosome 19 at 59,300,929 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0418 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038620-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text