Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0418Btlr/Mmmh
Stock Number:
038620-MU
Citation ID:
RRID:MMRRC_038620-MU
Other Names:
R0418 (G1), C57BL/6J-MtgxR0418Btlr
Major Collection:

Strain Information

Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Irx3
Name: Iroquois related homeobox 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16373
Homologene: 7385
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Mapk14
Name: mitogen-activated protein kinase 14
Synonyms: p38-alpha, p38, p38 MAP Kinase, Mxi2, CSBP2, Crk1, Csbp1, p38MAPK, p38a, p38 alpha, p38alpha, p38 MAP kinase alpha, p38 MAPK
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26416
HGNC: HGNC:6876
Homologene: 31777
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,326,502 bp
  • A to T, chromosome 1 at 74,490,107 bp
  • G to A, chromosome 1 at 118,840,490 bp
  • A to G, chromosome 1 at 132,611,595 bp
  • C to A, chromosome 1 at 158,716,990 bp
  • C to T, chromosome 1 at 161,834,850 bp
  • T to G, chromosome 2 at 28,733,856 bp
  • G to T, chromosome 2 at 104,123,330 bp
  • T to A, chromosome 3 at 28,570,880 bp
  • A to T, chromosome 3 at 30,689,234 bp
  • T to A, chromosome 3 at 66,255,028 bp
  • C to A, chromosome 3 at 101,435,435 bp
  • C to T, chromosome 4 at 118,893,251 bp
  • A to G, chromosome 4 at 129,223,684 bp
  • T to A, chromosome 5 at 8,713,281 bp
  • A to T, chromosome 5 at 86,557,011 bp
  • C to T, chromosome 5 at 109,452,881 bp
  • T to C, chromosome 6 at 43,307,235 bp
  • A to G, chromosome 6 at 90,569,893 bp
  • A to G, chromosome 7 at 28,733,491 bp
  • A to G, chromosome 7 at 40,902,452 bp
  • A to G, chromosome 7 at 44,813,397 bp
  • T to C, chromosome 7 at 78,844,017 bp
  • A to C, chromosome 7 at 87,002,403 bp
  • G to A, chromosome 7 at 104,049,772 bp
  • T to C, chromosome 7 at 120,207,434 bp
  • A to G, chromosome 8 at 10,569,918 bp
  • G to A, chromosome 8 at 91,800,080 bp
  • C to T, chromosome 8 at 95,095,658 bp
  • A to T, chromosome 9 at 15,734,266 bp
  • A to T, chromosome 9 at 16,246,896 bp
  • T to G, chromosome 9 at 26,794,101 bp
  • T to C, chromosome 9 at 32,452,129 bp
  • T to A, chromosome 9 at 55,437,413 bp
  • C to A, chromosome 9 at 85,844,750 bp
  • T to C, chromosome 10 at 4,427,693 bp
  • G to T, chromosome 10 at 40,040,631 bp
  • G to T, chromosome 10 at 50,748,926 bp
  • A to G, chromosome 10 at 70,534,761 bp
  • C to T, chromosome 10 at 79,762,643 bp
  • A to G, chromosome 10 at 88,886,558 bp
  • A to T, chromosome 10 at 94,181,512 bp
  • T to C, chromosome 10 at 107,023,912 bp
  • G to A, chromosome 10 at 121,417,170 bp
  • G to A, chromosome 10 at 128,670,885 bp
  • A to G, chromosome 11 at 29,533,401 bp
  • T to C, chromosome 11 at 94,091,753 bp
  • T to G, chromosome 11 at 103,503,438 bp
  • A to G, chromosome 13 at 11,834,095 bp
  • T to C, chromosome 13 at 47,244,490 bp
  • T to A, chromosome 14 at 103,603,254 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • C to T, chromosome 15 at 76,298,487 bp
  • A to T, chromosome 15 at 76,911,386 bp
  • T to C, chromosome 15 at 80,913,323 bp
  • T to C, chromosome 17 at 28,691,789 bp
  • G to T, chromosome 17 at 35,017,957 bp
  • C to T, chromosome 17 at 56,194,404 bp
  • T to A, chromosome 18 at 36,634,300 bp
  • T to C, chromosome 19 at 20,629,049 bp
  • A to G, chromosome 19 at 55,272,806 bp
  • G to A, chromosome 19 at 59,300,929 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0418 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038620-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.