Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0421Btlr/Mmmh
Stock Number:
038623-MU
Citation ID:
RRID:MMRRC_038623-MU
Other Names:
R0421 (G1), C57BL/6J-MtgxR0421Btlr
Major Collection:

Strain Information

Chrna6
Name: cholinergic receptor, nicotinic, alpha polypeptide 6
Synonyms: Acra6, alpha6 nAChR
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11440
Homologene: 20888
Plk3
Name: polo like kinase 3
Synonyms: Cnk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12795
HGNC: HGNC:2154
Homologene: 20865
Cdk13
Name: cyclin dependent kinase 13
Synonyms: 2310015O17Rik, Cdc2l5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69562
VEGA: 13
HGNC: HGNC:1733
Homologene: 135707
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Vps53
Name: VPS53 GARP complex subunit
Synonyms: 2310040I21Rik, 2010002A08Rik, 3100002B05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68299
Homologene: 6264
Clasp2
Name: CLIP associating protein 2
Synonyms: 1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76499
VEGA: 9
Homologene: 24944
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 60,268,439 bp
  • T to A, chromosome 1 at 151,709,082 bp
  • A to G, chromosome 1 at 151,792,438 bp
  • A to T, chromosome 1 at 158,848,080 bp
  • G to A, chromosome 2 at 22,960,827 bp
  • T to C, chromosome 2 at 26,668,649 bp
  • A to G, chromosome 2 at 36,869,641 bp
  • T to C, chromosome 2 at 66,543,277 bp
  • T to C, chromosome 2 at 130,276,772 bp
  • T to C, chromosome 2 at 157,005,869 bp
  • T to A, chromosome 2 at 181,588,258 bp
  • C to A, chromosome 3 at 20,029,316 bp
  • G to A, chromosome 3 at 58,417,328 bp
  • C to T, chromosome 3 at 87,083,607 bp
  • T to C, chromosome 3 at 92,868,984 bp
  • A to C, chromosome 3 at 107,194,504 bp
  • A to G, chromosome 4 at 32,684,707 bp
  • A to G, chromosome 4 at 112,019,014 bp
  • A to G, chromosome 4 at 117,133,444 bp
  • A to T, chromosome 5 at 5,557,290 bp
  • A to C, chromosome 5 at 30,371,568 bp
  • T to A, chromosome 5 at 33,134,652 bp
  • G to A, chromosome 5 at 38,674,575 bp
  • A to G, chromosome 5 at 57,720,060 bp
  • T to G, chromosome 5 at 109,059,428 bp
  • A to G, chromosome 5 at 130,253,933 bp
  • T to A, chromosome 5 at 144,989,741 bp
  • C to A, chromosome 6 at 113,813,888 bp
  • T to G, chromosome 7 at 41,865,204 bp
  • A to G, chromosome 7 at 104,596,722 bp
  • C to T, chromosome 7 at 118,855,629 bp
  • T to C, chromosome 7 at 126,563,712 bp
  • G to A, chromosome 7 at 126,825,015 bp
  • G to A, chromosome 7 at 139,908,996 bp
  • A to G, chromosome 8 at 13,045,097 bp
  • T to C, chromosome 8 at 27,408,387 bp
  • A to T, chromosome 8 at 70,295,632 bp
  • A to G, chromosome 9 at 15,059,160 bp
  • A to G, chromosome 9 at 20,101,475 bp
  • G to A, chromosome 9 at 21,976,032 bp
  • A to G, chromosome 9 at 22,250,547 bp
  • T to A, chromosome 9 at 73,933,210 bp
  • A to T, chromosome 9 at 82,926,457 bp
  • T to C, chromosome 9 at 105,784,206 bp
  • T to A, chromosome 9 at 111,391,839 bp
  • G to A, chromosome 9 at 113,854,302 bp
  • A to T, chromosome 9 at 123,779,606 bp
  • G to T, chromosome 10 at 50,748,926 bp
  • T to C, chromosome 10 at 58,984,075 bp
  • T to C, chromosome 11 at 69,908,534 bp
  • A to G, chromosome 11 at 76,082,670 bp
  • T to C, chromosome 11 at 106,148,915 bp
  • A to G, chromosome 11 at 109,527,766 bp
  • A to C, chromosome 11 at 119,447,257 bp
  • A to T, chromosome 12 at 72,653,086 bp
  • T to C, chromosome 13 at 17,763,170 bp
  • C to A, chromosome 13 at 104,242,403 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • A to T, chromosome 15 at 21,480,224 bp
  • A to T, chromosome 15 at 28,229,541 bp
  • A to G, chromosome 17 at 32,975,923 bp
  • A to T, chromosome 17 at 43,611,412 bp
  • T to A, chromosome 17 at 55,865,248 bp
  • C to T, chromosome 18 at 20,579,391 bp
  • C to A, chromosome 18 at 35,653,030 bp
  • T to A, chromosome 18 at 37,422,480 bp
  • T to A, chromosome 18 at 58,027,804 bp
  • T to C, chromosome 18 at 61,751,874 bp
  • T to C, chromosome 19 at 17,123,311 bp
  • T to G, chromosome 19 at 47,835,575 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0421 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038623-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.