Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0421Btlr/Mmmh
Stock Number:
038623-MU
Citation ID:
RRID:MMRRC_038623-MU
Other Names:
R0421 (G1), C57BL/6J-MtgxR0421Btlr
Major Collection:

Strain Information

Chrna6
Name: cholinergic receptor, nicotinic, alpha polypeptide 6
Synonyms: Acra6, alpha6 nAChR
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11440
Homologene: 20888
Plk3
Name: polo like kinase 3
Synonyms: Cnk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12795
HGNC: HGNC:2154
Homologene: 20865
Cdk13
Name: cyclin dependent kinase 13
Synonyms: 2310015O17Rik, Cdc2l5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69562
VEGA: 13
HGNC: HGNC:1733
Homologene: 135707
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Vps53
Name: VPS53 GARP complex subunit
Synonyms: 2310040I21Rik, 2010002A08Rik, 3100002B05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68299
Homologene: 6264
Clasp2
Name: CLIP associating protein 2
Synonyms: 1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76499
VEGA: 9
Homologene: 24944
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Eif3c
Name: eukaryotic translation initiation factor 3, subunit C
Synonyms: NIPIL(A3), 110kDa, 3230401O13Rik, Eif3s8, Xsl, Xs
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56347
Homologene: 2781
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Zfp472
Name: zinc finger protein 472
Synonyms: Krim-1, Krim-1B, Krim-1A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224691
Homologene: 77422
Nop56
Name: NOP56 ribonucleoprotein
Synonyms: NOP56, 56kDa with KKE/D repeat, 2310044F10Rik, Nol5a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67134
Homologene: 4660
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22772
Homologene: 5171
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Arsg
Name: arylsulfatase G
Synonyms: 6330406P08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74008
Homologene: 8978
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Neph1, Kirrel1, 6720469N11Rik, Kirrel
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170643
Homologene: 10089
Knop1
Name: lysine rich nucleolar protein 1
Synonyms: Tsg118, 2310008H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66356
Homologene: 49729
Edem3
Name: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: 2310050N11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66967
Homologene: 11866
Tsc22d2
Name: TSC22 domain family, member 2
Synonyms: 1810043J12Rik, 5530402M19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72033
Homologene: 8860
Cenpk
Name: centromere protein K
Synonyms: C530004N04Rik, B130045K24Rik, Solt
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 60411
VEGA: 13
Homologene: 11035
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Zfp599
Name: zinc finger protein 599
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235048
Homologene: 138456
Pla2g7
Name: phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
Synonyms: PAF acetylhydrolase, PAF-AH
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27226
HGNC: HGNC:9040
Homologene: 3725
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, D6Abb2e, wms, jog, Tmy, Gena300
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
F10
Name: coagulation factor X
Synonyms: fX, Cf10, AI194738
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14058
HGNC: HGNC:3528
Homologene: 30976
Hps3
Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms: Hermansky-Pudlak syndrome 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12807
Homologene: 13019
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Pcdh7
Name: protocadherin 7
Synonyms: BH-protocadherin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54216
HGNC: HGNC:8659
Homologene: 36101
Pcdhb11
Name: protocadherin beta 11
Synonyms: Pcdhb5E, PcdhbK
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93882
HGNC: HGNC:8690
Homologene: 62178
Hephl1
Name: hephaestin-like 1
Synonyms: LOC244698, Zp, zyklopen, thd, cw
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244698
Homologene: 9112
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Afap1l1
Name: actin filament associated protein 1-like 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106877
Homologene: 18728
Or1j20
Name: olfactory receptor family 1 subfamily J member 20
Synonyms: GA_x6K02T2NLDC-33564136-33565083, MOR136-10, Olfr352
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258942
Homologene: 121523
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Kcna10
Name: potassium voltage-gated channel, shaker-related subfamily, member 10
Synonyms: Kv1.8, Kcna8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242151
HGNC: HGNC:6219
Homologene: 4054
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Kpna7
Name: karyopherin subunit alpha 7
Synonyms: LOC381686, importin alpha 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381686
Homologene: 73467
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245026
Homologene: 18260
Cdh12
Name: cadherin 12
Synonyms: Br-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 215654
HGNC: HGNC:1751
Homologene: 37873
Rgl3
Name: ral guanine nucleotide dissociation stimulator-like 3
Synonyms: 1300003D20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71746
VEGA: 9
Homologene: 11363
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Zfp518b
Name: zinc finger protein 518B
Synonyms: 6820424L24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100515
Homologene: 19115
Vmn2r58
Name: vomeronasal 2, receptor 58
Synonyms: EG628422
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628422
Slc5a1
Name: solute carrier family 5 (sodium/glucose cotransporter), member 1
Synonyms: Sglt1, sodium glucose cotransporter 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20537
Homologene: 55456
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Prob1
Name: proline rich basic protein 1
Synonyms: LOC381148, Gm1614
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381148
Homologene: 83773
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: 4930428C11Rik, 4632415N18Rik, 4930463G05Rik, D19Ertd652e, Wdr96
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Ddx49
Name: DEAD box helicase 49
Synonyms: R27090_2, DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234374
Homologene: 41308
Ccr9
Name: C-C motif chemokine receptor 9
Synonyms: GPR-9-6, Cmkbr10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12769
HGNC: HGNC:1610
Homologene: 22546
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Lcn4
Name: lipocalin 4
Synonyms: Vnsp2, A630045M08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16821
Homologene: 86960
Dsn1
Name: DSN1 homolog, MIS12 kinetochore complex component
Synonyms: 1700022L09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66934
Homologene: 49806
Zfp512b
Name: zinc finger protein 512B
Synonyms: LOC269401, Znf512b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269401
Homologene: 69314
Kplce
Name: KPRP N-terminal and LCE C-terminal like protein
Synonyms: 2310050C09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66533
Homologene: 104374
Skint1
Name: selection and upkeep of intraepithelial T cells 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639781
Homologene: 87538
Gtpbp10
Name: GTP-binding protein 10 (putative)
Synonyms: 4930545J22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207704
Homologene: 8114
Sbds
Name: SBDS ribosome maturation factor
Synonyms: 4733401P19Rik, Shwachman-Bodian-Diamond syndrome homolog (human)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66711
Homologene: 6438
Or52ac1
Name: olfactory receptor family 52 subfamily AC member 1
Synonyms: GA_x6K02T2PBJ9-7224628-7223702, MOR38-1, Olfr655
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258817
Homologene: 17403
Tlcd3b
Name: TLC domain containing 3B
Synonyms: A330104J06Rik, 1500016O10Rik, Fam57b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68952
Homologene: 69491
Or7e174
Name: olfactory receptor family 7 subfamily E member 174
Synonyms: GA_x6K02T2PVTD-13841888-13842802, MOR145-4, Olfr868
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258552
HGNC: HGNC:8396
Homologene: 74168
Sh3rf3
Name: SH3 domain containing ring finger 3
Synonyms: 4831416G18Rik, Sh3md4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237353
Homologene: 77551
Map3k3
Name: mitogen-activated protein kinase kinase kinase 3
Synonyms: MAPKKK3, Mekk3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26406
HGNC: HGNC:6855
Homologene: 69110
Dhrs7
Name: dehydrogenase/reductase 7
Synonyms: retDSR4, retSDR4, 2310016E22Rik, 5730564L20Rik, dehydrogenase/reductase (SDR family) member 7
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66375
VEGA: 12
Homologene: 9350
Zfp119a
Name: zinc finger protein 119a
Synonyms: Mzf13, Zfp119
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 104349
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 60,268,439 bp
  • T to A, chromosome 1 at 151,709,082 bp
  • A to G, chromosome 1 at 151,792,438 bp
  • A to T, chromosome 1 at 158,848,080 bp
  • G to A, chromosome 2 at 22,960,827 bp
  • T to C, chromosome 2 at 26,668,649 bp
  • A to G, chromosome 2 at 36,869,641 bp
  • T to C, chromosome 2 at 66,543,277 bp
  • T to C, chromosome 2 at 130,276,772 bp
  • T to C, chromosome 2 at 157,005,869 bp
  • T to A, chromosome 2 at 181,588,258 bp
  • C to A, chromosome 3 at 20,029,316 bp
  • G to A, chromosome 3 at 58,417,328 bp
  • C to T, chromosome 3 at 87,083,607 bp
  • T to C, chromosome 3 at 92,868,984 bp
  • A to C, chromosome 3 at 107,194,504 bp
  • A to G, chromosome 4 at 32,684,707 bp
  • A to G, chromosome 4 at 112,019,014 bp
  • A to G, chromosome 4 at 117,133,444 bp
  • A to T, chromosome 5 at 5,557,290 bp
  • A to C, chromosome 5 at 30,371,568 bp
  • T to A, chromosome 5 at 33,134,652 bp
  • G to A, chromosome 5 at 38,674,575 bp
  • A to G, chromosome 5 at 57,720,060 bp
  • T to G, chromosome 5 at 109,059,428 bp
  • A to G, chromosome 5 at 130,253,933 bp
  • T to A, chromosome 5 at 144,989,741 bp
  • C to A, chromosome 6 at 113,813,888 bp
  • T to G, chromosome 7 at 41,865,204 bp
  • A to G, chromosome 7 at 104,596,722 bp
  • C to T, chromosome 7 at 118,855,629 bp
  • T to C, chromosome 7 at 126,563,712 bp
  • G to A, chromosome 7 at 126,825,015 bp
  • G to A, chromosome 7 at 139,908,996 bp
  • A to G, chromosome 8 at 13,045,097 bp
  • T to C, chromosome 8 at 27,408,387 bp
  • A to T, chromosome 8 at 70,295,632 bp
  • A to G, chromosome 9 at 15,059,160 bp
  • A to G, chromosome 9 at 20,101,475 bp
  • G to A, chromosome 9 at 21,976,032 bp
  • A to G, chromosome 9 at 22,250,547 bp
  • T to A, chromosome 9 at 73,933,210 bp
  • A to T, chromosome 9 at 82,926,457 bp
  • T to C, chromosome 9 at 105,784,206 bp
  • T to A, chromosome 9 at 111,391,839 bp
  • G to A, chromosome 9 at 113,854,302 bp
  • A to T, chromosome 9 at 123,779,606 bp
  • G to T, chromosome 10 at 50,748,926 bp
  • T to C, chromosome 10 at 58,984,075 bp
  • T to C, chromosome 11 at 69,908,534 bp
  • A to G, chromosome 11 at 76,082,670 bp
  • T to C, chromosome 11 at 106,148,915 bp
  • A to G, chromosome 11 at 109,527,766 bp
  • A to C, chromosome 11 at 119,447,257 bp
  • A to T, chromosome 12 at 72,653,086 bp
  • T to C, chromosome 13 at 17,763,170 bp
  • C to A, chromosome 13 at 104,242,403 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • A to T, chromosome 15 at 21,480,224 bp
  • A to T, chromosome 15 at 28,229,541 bp
  • A to G, chromosome 17 at 32,975,923 bp
  • A to T, chromosome 17 at 43,611,412 bp
  • T to A, chromosome 17 at 55,865,248 bp
  • C to T, chromosome 18 at 20,579,391 bp
  • C to A, chromosome 18 at 35,653,030 bp
  • T to A, chromosome 18 at 37,422,480 bp
  • T to A, chromosome 18 at 58,027,804 bp
  • T to C, chromosome 18 at 61,751,874 bp
  • T to C, chromosome 19 at 17,123,311 bp
  • T to G, chromosome 19 at 47,835,575 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0421 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038623-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.