Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0566Btlr/Mmmh
Stock Number:
038757-MU
Citation ID:
RRID:MMRRC_038757-MU
Other Names:
R0566 (G1), C57BL/6J-MtgxR0566Btlr
Major Collection:

Strain Information

Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Dhx15
Name: DEAH-box helicase 15
Synonyms: mDEAH9, DBP1, HRH2, Ddx15, DEAH (Asp-Glu-Ala-His) box polypeptide 15
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13204
HGNC: HGNC:2738
Homologene: 1040
Vps26a
Name: VPS26 retromer complex component A
Synonyms: HB58, H beta 58, Vps26
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 30930
VEGA: 10
Homologene: 68420
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Adamts6
Name: ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms: ADAM-TS6, A930019D11Rik, b2b2228Clo, b2b2187.1Clo, b2b2182Clo, b2b2029Clo, b2b1879.1Clo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Slc35e1
Name: solute carrier family 35, member E1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270066
Homologene: 49075
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195046
Homologene: 133820
Samd3
Name: sterile alpha motif domain containing 3
Synonyms: LOC268288
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268288
VEGA: 10
Homologene: 67991
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Or2r2
Name: olfactory receptor family 2 subfamily R member 2
Synonyms: GA_x6K02T2P3E9-5073878-5074816, MOR257-7P, Olfr456
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259144
Homologene: 79406
Tmem208
Name: transmembrane protein 208
Synonyms: 2610030K20Rik, 1700006C06Rik, Hspc171
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66320
Homologene: 40930
Mto1
Name: mitochondrial tRNA translation optimization 1
Synonyms: 2310039H01Rik, 5730419A02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68291
Homologene: 5876
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Paqr8
Name: progestin and adipoQ receptor family member VIII
Synonyms: 3110001D06Rik, 1700019B16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74229
Homologene: 32702
Acsf3
Name: acyl-CoA synthetase family member 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257633
Homologene: 14958
Piwil2
Name: piwi-like RNA-mediated gene silencing 2
Synonyms: Miwi like, mili
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57746
VEGA: 14
Homologene: 23071
Prr23a2
Name: proline rich 23A, member 2
Synonyms: Gm6406
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 623186
Homologene: 67036
Ccdc112
Name: coiled-coil domain containing 112
Synonyms: 8430438M01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240261
VEGA: 18
Homologene: 17617
Gnpda2
Name: glucosamine-6-phosphate deaminase 2
Synonyms: 4921523I18Rik, Gnp2, 4933412A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67980
Homologene: 12381
Zfp112
Name: zinc finger protein 112
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57745
Homologene: 49338
Prima1
Name: proline rich membrane anchor 1
Synonyms: B230212M13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 170952
Homologene: 15783
Prl7c1
Name: prolactin family 7, subfamily c, member 1
Synonyms: PLP-O, 1600017N11Rik, Prlpo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67505
Homologene: 137377
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 20,935,463 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • A to T, chromosome 4 at 156,217,859 bp
  • T to G, chromosome 5 at 52,171,425 bp
  • A to G, chromosome 5 at 69,584,961 bp
  • T to C, chromosome 5 at 73,064,497 bp
  • A to G, chromosome 6 at 5,232,408 bp
  • T to A, chromosome 6 at 42,487,091 bp
  • T to C, chromosome 7 at 24,125,677 bp
  • A to G, chromosome 7 at 105,759,195 bp
  • A to T, chromosome 7 at 123,170,913 bp
  • A to G, chromosome 7 at 132,991,147 bp
  • T to C, chromosome 8 at 72,492,571 bp
  • T to C, chromosome 8 at 105,334,843 bp
  • T to C, chromosome 8 at 122,781,527 bp
  • T to C, chromosome 9 at 78,448,301 bp
  • T to A, chromosome 9 at 98,856,988 bp
  • T to C, chromosome 10 at 26,244,498 bp
  • A to G, chromosome 10 at 62,480,546 bp
  • A to G, chromosome 11 at 71,122,942 bp
  • C to A, chromosome 12 at 103,197,314 bp
  • A to G, chromosome 13 at 27,778,978 bp
  • C to A, chromosome 13 at 104,444,927 bp
  • A to T, chromosome 14 at 50,845,414 bp
  • A to G, chromosome 14 at 70,410,394 bp
  • A to C, chromosome 18 at 46,290,810 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0566 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038757-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.