Strain Name:
C57BL/6J-MtgxR0568Btlr/Mmmh
Stock Number:
038759-MU
Citation ID:
RRID:MMRRC_038759-MU
Other Names:
R0568 (G1), C57BL/6J-MtgxR0568Btlr
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223838
Homologene: 11808
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 29808
Homologene: 49351
Syngr3
Name: synaptogyrin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20974
Homologene: 3101
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Hspa4
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: Mtb, 5830426I05Rik, Luzp5, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Smc4
Name: structural maintenance of chromosomes 4
Synonyms: 2500002A22Rik, Smc4l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70099
Homologene: 4015
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Trim66
Name: tripartite motif-containing 66
Synonyms: D7H11orf29, Tif1d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330627
Homologene: 28044
Gna12
Name: guanine nucleotide binding protein, alpha 12
Synonyms: Galpha12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14673
HGNC: HGNC:4380
Homologene: 22398
Brms1l
Name: breast cancer metastasis-suppressor 1-like
Synonyms: 0710008O11Rik, BRMS1, D12Ertd407e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 52592
VEGA: 12
Homologene: 9123
Tent2
Name: terminal nucleotidyltransferase 2
Synonyms: 8030446C20Rik, Papd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100715
VEGA: 13
Homologene: 44022
Snrnp40
Name: small nuclear ribonucleoprotein 40 (U5)
Synonyms: 0610009C03Rik, Wdr57
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66585
Homologene: 3538
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Cnpy4
Name: canopy FGF signaling regulator 4
Synonyms: 2610019P18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 66455
Homologene: 15196
Hspbp1
Name: HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms: 1500019G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 66245
Homologene: 40827
Plxna2
Name: plexin A2
Synonyms: OCT, Plxn2, 2810428A13Rik, PlexA2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
C8b
Name: complement component 8, beta polypeptide
Synonyms: 4930439B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 110382
HGNC: HGNC:1353
Homologene: 48
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTP-BL, Ptpri, PTPL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Pitpnm2
Name: phosphatidylinositol transfer protein, membrane-associated 2
Synonyms: RDGBA2, NIR3, Rdgb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19679
Homologene: 7915
Gtf2ird2
Name: GTF2I repeat domain containing 2
Synonyms: 1700012P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 114674
Homologene: 24941
Lipo3
Name: lipase, member O3
Synonyms: Lipo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381236
Homologene: 103863
Cfap410
Name: cilia and flagella associated protein 410
Synonyms: D10Jhu13e, 1810043G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67884
HGNC: HGNC:1260
Homologene: 3619
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Or4c107
Name: olfactory receptor family 4 subfamily C member 107
Synonyms: GA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17, Olfr1212
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258241
Homologene: 66154
Ugt2b5
Name: UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms: Udpgt-3, m-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22238
Homologene: 137225
Gm4553
Name: predicted gene 4553
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100043617
Acnat1
Name: acyl-coenzyme A amino acid N-acyltransferase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230161
Homologene: 28287
Bag2
Name: BCL2-associated athanogene 2
Synonyms: 2610042A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213539
HGNC: HGNC:938
Homologene: 31233
Tprn
Name: taperin
Synonyms: C430004E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 97031
Homologene: 52156
Lxn
Name: latexin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 17035
Homologene: 36361
Zswim9
Name: zinc finger SWIM-type containing 9
Synonyms: 6330408A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 321008
Homologene: 52386
Vps9d1
Name: VPS9 domain containing 1
Synonyms: 2410004N05Rik, 1300018I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72325
Homologene: 21021
Lrrc3
Name: leucine rich repeat containing 3
Synonyms: 1300011L04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237387
Homologene: 12789
Polr3d
Name: polymerase (RNA) III (DNA directed) polypeptide D
Synonyms: 2810426M17Rik, 44kDa, TSBN51, BN51T, RPC4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67065
VEGA: 14
HGNC: HGNC:1080
Homologene: 1303
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 33,746,978 bp
  • T to C, chromosome 1 at 172,112,137 bp
  • T to C, chromosome 1 at 194,751,386 bp
  • T to C, chromosome 2 at 25,264,321 bp
  • C to A, chromosome 2 at 31,415,236 bp
  • T to A, chromosome 2 at 88,959,043 bp
  • T to C, chromosome 2 at 119,935,422 bp
  • C to T, chromosome 3 at 67,461,002 bp
  • T to C, chromosome 3 at 69,022,461 bp
  • G to A, chromosome 4 at 49,451,003 bp
  • T to C, chromosome 4 at 86,418,552 bp
  • A to G, chromosome 4 at 104,793,380 bp
  • C to G, chromosome 4 at 130,378,043 bp
  • G to A, chromosome 5 at 87,137,365 bp
  • T to C, chromosome 5 at 103,489,765 bp
  • A to G, chromosome 5 at 124,140,517 bp
  • G to T, chromosome 5 at 134,211,242 bp
  • A to G, chromosome 5 at 138,192,577 bp
  • A to G, chromosome 5 at 140,760,883 bp
  • A to T, chromosome 7 at 4,684,432 bp
  • A to T, chromosome 7 at 13,261,026 bp
  • A to G, chromosome 7 at 81,464,629 bp
  • T to C, chromosome 7 at 109,460,695 bp
  • G to T, chromosome 7 at 142,165,620 bp
  • A to G, chromosome 8 at 123,246,748 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • A to T, chromosome 10 at 7,712,528 bp
  • T to A, chromosome 10 at 77,901,585 bp
  • C to T, chromosome 10 at 77,983,038 bp
  • A to T, chromosome 10 at 77,984,547 bp
  • A to G, chromosome 11 at 53,262,876 bp
  • A to G, chromosome 12 at 55,861,388 bp
  • T to A, chromosome 12 at 116,423,215 bp
  • A to G, chromosome 13 at 93,154,992 bp
  • A to T, chromosome 14 at 70,439,519 bp
  • T to C, chromosome 15 at 94,291,713 bp
  • C to T, chromosome 17 at 24,686,581 bp
  • T to C, chromosome 19 at 33,582,042 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0568 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038759-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.