Strain Name:
C57BL/6J-MtgxR0593Btlr/Mmmh
Stock Number:
038783-MU
Citation ID:
RRID:MMRRC_038783-MU
Other Names:
R0593 (G1), C57BL/6J-MtgxR0593Btlr
Major Collection:

Strain Information

Cds2
Name: CDP-diacylglycerol synthase 2
Synonyms: D2Wsu127e, 5730460C18Rik, 5730450N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110911
HGNC: HGNC:1801
Homologene: 37854
Ifi203
Name: interferon activated gene 203
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15950
HGNC: HGNC:5395
Homologene: 115929
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: b2b1625.2Clo, D230004K18Rik, Megalin, Gp330
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: p53BP1, 53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Hook1
Name: hook microtubule tethering protein 1
Synonyms: azh, abnormal spermatozoon head shape, A930033L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77963
Homologene: 9289
Eif2d
Name: eukaryotic translation initiation factor 2D
Synonyms: Lgtn, D1Ertd5e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16865
HGNC: HGNC:6583
Homologene: 38244
Clock
Name: clock circadian regulator
Synonyms: KAT13D, 5330400M04Rik, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Gucy2c
Name: guanylate cyclase 2c
Synonyms: GC-C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14917
HGNC: HGNC:4688
Homologene: 3641
Arhgap17
Name: Rho GTPase activating protein 17
Synonyms: WBP15, Nadrin, Nadrin2, 5730403H17Rik, Rich1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70497
Homologene: 9984
Irf7
Name: interferon regulatory factor 7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54123
HGNC: HGNC:6122
Homologene: 128624
Cops6
Name: COP9 signalosome subunit 6
Synonyms: VIP/MOV34, Sgn3, COP9 complex S6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26893
Homologene: 4977
Mtx2
Name: metaxin 2
Synonyms: 1500012G02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53375
HGNC: HGNC:7506
Homologene: 4777
Alox12e
Name: arachidonate lipoxygenase, epidermal
Synonyms: e-LOX1, Alox12-ps2, Alox12-ps1, 8-LOX, Aloxe
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11685
Homologene: 105868
Dscam
Name: DS cell adhesion molecule
Synonyms: Down syndrome cell adhesion molecule, 4932410A21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Ankrd50
Name: ankyrin repeat domain 50
Synonyms: E430012K20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99696
Homologene: 129859
Adam34
Name: a disintegrin and metallopeptidase domain 34
Synonyms: testase 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 252866
Homologene: 78104
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Dcaf17
Name: DDB1 and CUL4 associated factor 17
Synonyms: A930009G19Rik, A030004A10Rik, 2810055O12Rik, 4833418A01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75763
Homologene: 65979
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Tex10
Name: testis expressed gene 10
Synonyms: 2810462N03Rik, clone 18330, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
Sec16b
Name: SEC16 homolog B, endoplasmic reticulum export factor
Synonyms: Lztr2, Rgpr, Rgpr-p117
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 89867
Homologene: 13227
Oosp1
Name: oocyte secreted protein 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170834
Homologene: 87189
Vmn1r113
Name: vomeronasal 1 receptor 113
Synonyms: Gm5748
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436135
Homologene: 104166
Slc22a14
Name: solute carrier family 22 (organic cation transporter), member 14
Synonyms: LOC382113
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382113
HGNC: HGNC:8495
Homologene: 3530
Ckmt2
Name: creatine kinase, mitochondrial 2
Synonyms: 2300008A19Rik, ScCKmit
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76722
HGNC: HGNC:1996
Homologene: 68206
Acmsd
Name: amino carboxymuconate semialdehyde decarboxylase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 266645
Homologene: 44520
Gal3st2b
Name: galactose-3-O-sulfotransferase 2B
Synonyms: Gm9994
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100041596
Homologene: 41471
Nelfcd
Name: negative elongation factor complex member C/D, Th1l
Synonyms: trihydrophobin 1, Th1l, 2410003I03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57314
Homologene: 9496
Or10am5
Name: olfactory receptor family 10 subfamily AM member 5
Synonyms: Olfr1349, MOR232-8, GA_x6K02T2QGBW-3245761-3244808
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269862
Homologene: 133589
Asah1
Name: N-acylsphingosine amidohydrolase 1
Synonyms: 2310081N20Rik, acid ceramidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11886
HGNC: HGNC:735
Homologene: 10504
Csnka2ip
Name: casein kinase 2, alpha prime interacting protein
Synonyms: Ckt2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224291
Homologene: 77570
Gm16490
Name: predicted gene 16490
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 102638785
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 93,940,827 bp
  • T to C, chromosome 1 at 127,738,603 bp
  • T to A, chromosome 1 at 131,155,728 bp
  • G to C, chromosome 1 at 157,532,148 bp
  • T to C, chromosome 1 at 173,928,649 bp
  • C to T, chromosome 2 at 69,467,006 bp
  • T to A, chromosome 2 at 71,087,400 bp
  • A to G, chromosome 2 at 74,869,436 bp
  • A to G, chromosome 2 at 121,270,528 bp
  • G to A, chromosome 2 at 132,297,376 bp
  • G to T, chromosome 2 at 174,423,430 bp
  • C to A, chromosome 3 at 38,483,007 bp
  • G to A, chromosome 3 at 133,488,109 bp
  • C to T, chromosome 4 at 48,456,800 bp
  • C to T, chromosome 4 at 95,998,786 bp
  • A to G, chromosome 5 at 76,265,836 bp
  • A to G, chromosome 5 at 138,163,580 bp
  • T to C, chromosome 6 at 136,728,335 bp
  • T to A, chromosome 7 at 6,514,809 bp
  • T to A, chromosome 7 at 20,787,463 bp
  • T to C, chromosome 7 at 123,286,743 bp
  • T to C, chromosome 7 at 141,265,062 bp
  • A to G, chromosome 8 at 41,349,582 bp
  • T to C, chromosome 8 at 43,651,687 bp
  • A to T, chromosome 9 at 108,110,306 bp
  • T to A, chromosome 9 at 119,169,851 bp
  • A to G, chromosome 11 at 70,320,897 bp
  • T to C, chromosome 11 at 110,068,099 bp
  • A to G, chromosome 13 at 91,853,638 bp
  • A to T, chromosome 16 at 64,478,612 bp
  • T to C, chromosome 16 at 96,772,408 bp
  • T to G, chromosome 18 at 35,770,385 bp
  • GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC to GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC, chromosome 19 at 6,245,007 bp
  • T to C, chromosome 19 at 11,668,412 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0593 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038783-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.