Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0611Btlr/Mmmh
Stock Number:
038800-MU
Citation ID:
RRID:MMRRC_038800-MU
Other Names:
R0611 (G1), C57BL/6J-MtgxR0611Btlr
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Trim32
Name: tripartite motif-containing 32
Synonyms: 3f3, 1810045E12Rik, Zfp117, BBS11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69807
Homologene: 36327
Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Nfia
Name: nuclear factor I/A
Synonyms: 1110047K16Rik, NF1-A, 9430022M17Rik, NF1A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18027
HGNC: HGNC:7784
Homologene: 4086
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Ubxn2a
Name: UBX domain protein 2A
Synonyms: 6330407P03Rik, Ubxd4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217379
Homologene: 17076
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 4632412M04Rik, 1200016K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 15,710,440 bp
  • A to C, chromosome 1 at 31,203,655 bp
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • C to T, chromosome 1 at 59,558,234 bp
  • A to T, chromosome 1 at 131,762,761 bp
  • A to G, chromosome 1 at 134,352,377 bp
  • A to C, chromosome 1 at 181,227,435 bp
  • T to C, chromosome 2 at 25,626,241 bp
  • C to A, chromosome 2 at 27,113,571 bp
  • T to C, chromosome 2 at 27,966,992 bp
  • A to T, chromosome 2 at 29,842,717 bp
  • C to G, chromosome 2 at 36,569,556 bp
  • A to G, chromosome 2 at 49,528,844 bp
  • T to C, chromosome 2 at 71,820,060 bp
  • T to C, chromosome 2 at 110,885,001 bp
  • C to T, chromosome 2 at 120,375,448 bp
  • G to T, chromosome 2 at 120,699,257 bp
  • T to C, chromosome 2 at 143,988,516 bp
  • A to T, chromosome 2 at 181,995,111 bp
  • T to A, chromosome 4 at 45,373,011 bp
  • T to C, chromosome 4 at 65,613,656 bp
  • A to G, chromosome 4 at 97,783,457 bp
  • T to A, chromosome 4 at 99,901,689 bp
  • A to G, chromosome 4 at 106,634,184 bp
  • C to T, chromosome 4 at 108,602,032 bp
  • T to C, chromosome 4 at 116,986,677 bp
  • A to G, chromosome 4 at 116,996,044 bp
  • A to T, chromosome 4 at 132,226,075 bp
  • C to A, chromosome 4 at 139,020,072 bp
  • A to G, chromosome 5 at 3,954,870 bp
  • T to C, chromosome 5 at 14,678,775 bp
  • T to C, chromosome 5 at 14,712,814 bp
  • C to A, chromosome 5 at 35,019,460 bp
  • T to C, chromosome 5 at 37,466,722 bp
  • A to G, chromosome 5 at 87,090,830 bp
  • A to G, chromosome 5 at 93,167,534 bp
  • T to C, chromosome 6 at 4,689,621 bp
  • A to T, chromosome 6 at 34,309,642 bp
  • A to G, chromosome 6 at 35,225,968 bp
  • A to T, chromosome 6 at 37,334,481 bp
  • A to G, chromosome 6 at 42,435,091 bp
  • A to T, chromosome 6 at 47,095,549 bp
  • C to A, chromosome 6 at 85,678,671 bp
  • A to G, chromosome 7 at 3,110,777 bp
  • A to G, chromosome 7 at 4,242,233 bp
  • T to C, chromosome 7 at 4,923,276 bp
  • C to T, chromosome 7 at 19,515,190 bp
  • A to T, chromosome 7 at 44,978,801 bp
  • A to G, chromosome 7 at 45,217,250 bp
  • T to A, chromosome 7 at 63,735,890 bp
  • T to A, chromosome 7 at 65,314,645 bp
  • A to G, chromosome 7 at 80,329,014 bp
  • T to G, chromosome 7 at 82,528,912 bp
  • T to A, chromosome 7 at 101,787,749 bp
  • T to C, chromosome 7 at 103,947,193 bp
  • T to A, chromosome 7 at 108,622,287 bp
  • T to A, chromosome 7 at 120,252,256 bp
  • T to C, chromosome 7 at 141,355,733 bp
  • T to G, chromosome 7 at 141,862,436 bp
  • A to G, chromosome 8 at 4,255,676 bp
  • G to A, chromosome 8 at 22,336,533 bp
  • A to G, chromosome 8 at 71,649,865 bp
  • G to A, chromosome 8 at 88,522,316 bp
  • A to G, chromosome 9 at 21,142,241 bp
  • A to G, chromosome 9 at 119,112,099 bp
  • C to T, chromosome 10 at 82,954,729 bp
  • G to A, chromosome 10 at 130,386,122 bp
  • T to C, chromosome 11 at 68,972,692 bp
  • T to C, chromosome 11 at 69,499,194 bp
  • G to A, chromosome 11 at 70,252,394 bp
  • A to G, chromosome 11 at 100,549,946 bp
  • A to G, chromosome 11 at 104,338,186 bp
  • G to A, chromosome 12 at 4,880,700 bp
  • A to G, chromosome 12 at 55,795,698 bp
  • A to T, chromosome 12 at 69,300,279 bp
  • A to C, chromosome 12 at 99,909,711 bp
  • T to G, chromosome 12 at 104,103,787 bp
  • T to A, chromosome 12 at 110,632,788 bp
  • T to A, chromosome 12 at 118,108,910 bp
  • G to A, chromosome 13 at 19,100,665 bp
  • T to A, chromosome 13 at 22,501,654 bp
  • A to T, chromosome 13 at 38,187,741 bp
  • T to A, chromosome 13 at 56,887,823 bp
  • T to C, chromosome 13 at 67,070,311 bp
  • C to T, chromosome 13 at 99,405,074 bp
  • A to G, chromosome 14 at 47,694,616 bp
  • G to A, chromosome 14 at 50,083,853 bp
  • T to G, chromosome 14 at 117,975,018 bp
  • C to A, chromosome 15 at 31,009,084 bp
  • A to G, chromosome 15 at 59,341,158 bp
  • G to A, chromosome 15 at 77,927,717 bp
  • A to G, chromosome 15 at 79,058,057 bp
  • T to A, chromosome 15 at 85,932,323 bp
  • T to C, chromosome 15 at 98,438,287 bp
  • T to G, chromosome 15 at 103,320,278 bp
  • A to G, chromosome 16 at 18,814,876 bp
  • A to G, chromosome 16 at 45,581,602 bp
  • A to T, chromosome 17 at 13,949,535 bp
  • A to C, chromosome 17 at 28,975,933 bp
  • A to G, chromosome 17 at 33,334,619 bp
  • A to G, chromosome 17 at 88,582,406 bp
  • A to G, chromosome 18 at 37,308,210 bp
  • T to G, chromosome 19 at 10,041,836 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0611 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038800-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.