Strain Name:
C57BL/6J-MtgxR0611Btlr/Mmmh
Stock Number:
038800-MU
Citation ID:
RRID:MMRRC_038800-MU
Other Names:
R0611 (G1), C57BL/6J-MtgxR0611Btlr
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66797
Homologene: 69159
Trim32
Name: tripartite motif-containing 32
Synonyms: 3f3, 1810045E12Rik, Zfp117, BBS11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69807
Homologene: 36327
Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Nfia
Name: nuclear factor I/A
Synonyms: 1110047K16Rik, NF1-A, 9430022M17Rik, NF1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18027
HGNC: HGNC:7784
Homologene: 4086
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Ubxn2a
Name: UBX domain protein 2A
Synonyms: 6330407P03Rik, Ubxd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217379
Homologene: 17076
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 4632412M04Rik, 1200016K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Txn2
Name: thioredoxin 2
Synonyms: 2510006J11Rik, Trx2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 56551
Homologene: 40849
Kansl1
Name: KAT8 regulatory NSL complex subunit 1
Synonyms: 1700081L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76719
Homologene: 9140
Prmt1
Name: protein arginine N-methyltransferase 1
Synonyms: 6720434D09Rik, Hrmt1l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15469
HGNC: HGNC:5187
Homologene: 21477
Mrps27
Name: mitochondrial ribosomal protein S27
Synonyms: 2610028H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218506
VEGA: 13
Homologene: 41006
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70699
Homologene: 45971
Tdp1
Name: tyrosyl-DNA phosphodiesterase 1
Synonyms: 4921509N21Rik, SCAN1, 2810481F14Rik, E430034L06Rik, Gm40556
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104884
Homologene: 5424
Septin11
Name: septin 11
Synonyms: 6230410I01Rik, D5Ertd606e, Sept11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 52398
Homologene: 56800
Epc2
Name: enhancer of polycomb homolog 2
Synonyms: D2Ertd694e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227867
Homologene: 32274
Ufd1
Name: ubiquitin recognition factor in ER-associated degradation 1
Synonyms: Ufd1, Ufd1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 22230
Homologene: 39090
Akap9
Name: A kinase (PRKA) anchor protein (yotiao) 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Tmem87a
Name: transmembrane protein 87A
Synonyms: A930025J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 211499
Homologene: 9165
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Clpb
Name: ClpB caseinolytic peptidase B
Synonyms: Skd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20480
Homologene: 32067
Unc45a
Name: unc-45 myosin chaperone A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101869
Homologene: 32423
Dsp
Name: desmoplakin
Synonyms: DP, 2300002E22Rik, 5730453H04Rik, rul
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Tjp1
Name: tight junction protein 1
Synonyms: ZO-1, ZO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21872
Homologene: 2445
Gmeb1
Name: glucocorticoid modulatory element binding protein 1
Synonyms: 1110050A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56809
HGNC: HGNC:4370
Homologene: 10647
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 672125
Homologene: 129606
Gpc6
Name: glypican 6
Synonyms: 6720429C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 23888
HGNC: HGNC:4454
Homologene: 55922
Amph
Name: amphiphysin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218038
HGNC: HGNC:471
Homologene: 121585
Cdc37
Name: cell division cycle 37
Synonyms: p50Cdc37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12539
VEGA: 9
HGNC: HGNC:1735
Homologene: 38268
Zfp81
Name: zinc finger protein 81
Synonyms: KRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224694
Homologene: 138633
Tmem183a
Name: transmembrane protein 183A
Synonyms: 1300007B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 57439
Homologene: 10757
Urm1
Name: ubiquitin related modifier 1
Synonyms: 2900073H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68205
Homologene: 41688
Ppp1r21
Name: protein phosphatase 1, regulatory subunit 21
Synonyms: 1110018J12Rik, Ccdc128, Klraq1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 73825
Homologene: 44811
Hectd3
Name: HECT domain E3 ubiquitin protein ligase 3
Synonyms: 1700064K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76608
Homologene: 18426
Rrbp1
Name: ribosome binding protein 1
Synonyms: mRRp0, ES/130, p180, mRRp1.8, mRRp2, mRRp5.4, mRRp10, mRRp16.8, mRRp15b, mRRp15a, mRRp41, mRRp47, 5730465C04Rik, 1700087N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 81910
Homologene: 68138
Stk38
Name: serine/threonine kinase 38
Synonyms: 5830476G13Rik, 9530097A09Rik, Ndr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106504
Homologene: 56033
Zfp708
Name: zinc finger protein 708
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 432769
Homologene: 134096
Stk32b
Name: serine/threonine kinase 32B
Synonyms: 2510009F08Rik, YANK2, STKG6, Stk32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 64293
Homologene: 48654
Eps8l2
Name: EPS8-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 98845
Homologene: 69358
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Ctnnd2
Name: catenin (cadherin associated protein), delta 2
Synonyms: Nprap, Catnd2, neurojugin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Trpc7
Name: transient receptor potential cation channel, subfamily C, member 7
Synonyms: TRP7, Trrp8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 26946
Homologene: 22689
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269959
Homologene: 18912
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26875
Homologene: 69111
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Pcdhb4
Name: protocadherin beta 4
Synonyms: Pcdhb5A, PcdhbD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93875
HGNC: HGNC:8690
Homologene: 62176
Slc9c1
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208169
Homologene: 19505
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, Dnahc11, avc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: T1 gene, T1, ST2, T1/ST2, Fit-1, DER4, ST2L, St2, St2-rs1, Ly84
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Efcab7
Name: EF-hand calcium binding domain 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230500
Homologene: 19952
Lgsn
Name: lengsin, lens protein with glutamine synthetase domain
Synonyms: Lgs, lengsin, Gluld1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 266744
Homologene: 9569
Otud7a
Name: OTU domain containing 7A
Synonyms: Cezanne 2 protein, Otud7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 170711
Homologene: 15642
Stard9
Name: START domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668880
Homologene: 130712
Ttc22
Name: tetratricopeptide repeat domain 22
Synonyms: 4732467L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230576
Homologene: 89253
Odad4
Name: outer dynein arm complex subunit 4
Synonyms: 4933404O19Rik, Ttc25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74407
Homologene: 12860
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Dcaf10
Name: DDB1 and CUL4 associated factor 10
Synonyms: Wdr32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242418
Homologene: 32581
Gm7168
Name: predicted gene 7168
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 635895
Homologene: 133217
Unc13a
Name: unc-13 homolog A
Synonyms: Munc13-1, 2410078G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382018
Homologene: 11279
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 625068
Homologene: 129606
Or1j15
Name: olfactory receptor family 1 subfamily J member 15
Synonyms: GA_x6K02T2NLDC-33262744-33263673, MOR136-12, Olfr344
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258621
Tas2r126
Name: taste receptor, type 2, member 126
Synonyms: Tas2r26, mGR26, T2R12, mt2r35, T2R26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387353
Homologene: 16412
Gm973
Name: predicted gene 973
Synonyms: LOC381260
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381260
Homologene: 124277
Abca14
Name: ATP-binding cassette, sub-family A (ABC1), member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67928
Homologene: 86128
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Tmco4
Name: transmembrane and coiled-coil domains 4
Synonyms: 4632413C14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77056
Homologene: 57112
Col5a1
Name: collagen, type V, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12831
HGNC: HGNC:2209
Homologene: 55434
Tpte
Name: transmembrane phosphatase with tensin homology
Synonyms: Pten2, Vsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234129
Homologene: 50411
Serpina5
Name: serine (or cysteine) peptidase inhibitor, clade A, member 5
Synonyms: Pci, antitrypsin, alpha-1 antiproteinase, PAI-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268591
HGNC: HGNC:8723
Homologene: 20159
Fam163b
Name: family with sequence similarity 163, member B
Synonyms: C630035N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 109349
Homologene: 106097
Alox12
Name: arachidonate 12-lipoxygenase
Synonyms: P-12LO, Alox12p, 9930022G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11684
HGNC: HGNC:429
Homologene: 560
Kcnb2
Name: potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms: Kv2.2, 9630047L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98741
HGNC: HGNC:6232
Homologene: 31263
Snapc2
Name: small nuclear RNA activating complex, polypeptide 2
Synonyms: 0610007H10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102209
Homologene: 2318
Or5p79
Name: olfactory receptor family 5 subfamily P member 79
Synonyms: GA_x6K02T2PBJ9-10951546-10952496, MOR204-7, Olfr507
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258738
Homologene: 27249
Fcna
Name: ficolin A
Synonyms: ficolin A, Fcn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14133
Homologene: 117949
A430110L20Rik
Name: RIKEN cDNA A430110L20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Zswim5
Name: zinc finger SWIM-type containing 5
Synonyms: 4933426E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74464
Homologene: 18958
Tead2
Name: TEA domain family member 2
Synonyms: TEF-4, TEAD-2, Etdf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21677
Homologene: 19662
Sgce
Name: sarcoglycan, epsilon
Synonyms: e-SG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20392
Homologene: 31205
Ano3
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228432
Homologene: 57147
Nkd1
Name: naked cuticle 1
Synonyms: 2810434J10Rik, 9030215G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93960
Homologene: 12343
Ugt2b36
Name: UDP glucuronosyltransferase 2 family, polypeptide B36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231396
Homologene: 128251
Lilra5
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Synonyms: Gm4878
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232801
Homologene: 83297
Akr1b1
Name: aldo-keto reductase family 1 member B
Synonyms: Ahr-1, Ahr1, Aldor1, Aldr1, ALR2, AR, Akr1b3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11677
HGNC: HGNC:381
Homologene: 133743
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Creb3l2
Name: cAMP responsive element binding protein 3-like 2
Synonyms: BBF2H7, C530025K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 208647
Homologene: 18690
Gm7353
Name: predicted pseudogene 7353
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 664817
Nat14
Name: N-acetyltransferase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269854
Homologene: 10689
Trappc6a
Name: trafficking protein particle complex 6A
Synonyms: 4930519D19Rik, 1810073E21Rik, TRS33
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67091
Homologene: 69370
Or51k2
Name: olfactory receptor family 51 subfamily K member 2
Synonyms: GA_x6K02T2PBJ9-6681230-6682168, MOR12-5, Olfr633
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258351
Homologene: 27136
Gm4799
Name: predicted gene 4799
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216185
VEGA: 10
Rangrf
Name: RAN guanine nucleotide release factor
Synonyms: Mog1, Rangnrf, 2400006H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 57785
Homologene: 41138
Klhdc2
Name: kelch domain containing 2
Synonyms: HCLP-1, 2310022K15Rik, D12Ertd522e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 69554
Homologene: 8631
Vmn1r202
Name: vomeronasal 1 receptor 202
Synonyms: V1ri7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171258
Homologene: 110880
Or4k15c
Name: olfactory receptor family 4 subfamily K member 15C
Synonyms: GA_x6K02T2PMLR-5775299-5774334, MOR246-4, Olfr726
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258313
Homologene: 44957
Ankrd54
Name: ankyrin repeat domain 54
Synonyms: C730048E16Rik, Liar
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223690
Homologene: 16352
Or8s10
Name: olfactory receptor family 8 subfamily S member 1
Synonyms: GA_x6K02T2NBG7-5293798-5292872, MOR160-2, Olfr282
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 258449
Homologene: 133621
Zfp385a
Name: zinc finger protein 385A
Synonyms: Hzf, Zfp385
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 29813
VEGA: 15
Homologene: 8479
Fads3
Name: fatty acid desaturase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 60527
VEGA: 19
HGNC: HGNC:3576
Homologene: 11025
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 15,710,440 bp
  • A to C, chromosome 1 at 31,203,655 bp
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • C to T, chromosome 1 at 59,558,234 bp
  • A to T, chromosome 1 at 131,762,761 bp
  • A to G, chromosome 1 at 134,352,377 bp
  • A to C, chromosome 1 at 181,227,435 bp
  • T to C, chromosome 2 at 25,626,241 bp
  • C to A, chromosome 2 at 27,113,571 bp
  • T to C, chromosome 2 at 27,966,992 bp
  • A to T, chromosome 2 at 29,842,717 bp
  • C to G, chromosome 2 at 36,569,556 bp
  • A to G, chromosome 2 at 49,528,844 bp
  • T to C, chromosome 2 at 71,820,060 bp
  • T to C, chromosome 2 at 110,885,001 bp
  • C to T, chromosome 2 at 120,375,448 bp
  • G to T, chromosome 2 at 120,699,257 bp
  • T to C, chromosome 2 at 143,988,516 bp
  • A to T, chromosome 2 at 181,995,111 bp
  • T to A, chromosome 4 at 45,373,011 bp
  • T to C, chromosome 4 at 65,613,656 bp
  • A to G, chromosome 4 at 97,783,457 bp
  • T to A, chromosome 4 at 99,901,689 bp
  • A to G, chromosome 4 at 106,634,184 bp
  • C to T, chromosome 4 at 108,602,032 bp
  • T to C, chromosome 4 at 116,986,677 bp
  • A to G, chromosome 4 at 116,996,044 bp
  • A to T, chromosome 4 at 132,226,075 bp
  • C to A, chromosome 4 at 139,020,072 bp
  • A to G, chromosome 5 at 3,954,870 bp
  • T to C, chromosome 5 at 14,678,775 bp
  • T to C, chromosome 5 at 14,712,814 bp
  • C to A, chromosome 5 at 35,019,460 bp
  • T to C, chromosome 5 at 37,466,722 bp
  • A to G, chromosome 5 at 87,090,830 bp
  • A to G, chromosome 5 at 93,167,534 bp
  • T to C, chromosome 6 at 4,689,621 bp
  • A to T, chromosome 6 at 34,309,642 bp
  • A to G, chromosome 6 at 35,225,968 bp
  • A to T, chromosome 6 at 37,334,481 bp
  • A to G, chromosome 6 at 42,435,091 bp
  • A to T, chromosome 6 at 47,095,549 bp
  • C to A, chromosome 6 at 85,678,671 bp
  • A to G, chromosome 7 at 3,110,777 bp
  • A to G, chromosome 7 at 4,242,233 bp
  • T to C, chromosome 7 at 4,923,276 bp
  • C to T, chromosome 7 at 19,515,190 bp
  • A to T, chromosome 7 at 44,978,801 bp
  • A to G, chromosome 7 at 45,217,250 bp
  • T to A, chromosome 7 at 63,735,890 bp
  • T to A, chromosome 7 at 65,314,645 bp
  • A to G, chromosome 7 at 80,329,014 bp
  • T to G, chromosome 7 at 82,528,912 bp
  • T to A, chromosome 7 at 101,787,749 bp
  • T to C, chromosome 7 at 103,947,193 bp
  • T to A, chromosome 7 at 108,622,287 bp
  • T to A, chromosome 7 at 120,252,256 bp
  • T to C, chromosome 7 at 141,355,733 bp
  • T to G, chromosome 7 at 141,862,436 bp
  • A to G, chromosome 8 at 4,255,676 bp
  • G to A, chromosome 8 at 22,336,533 bp
  • A to G, chromosome 8 at 71,649,865 bp
  • G to A, chromosome 8 at 88,522,316 bp
  • A to G, chromosome 9 at 21,142,241 bp
  • A to G, chromosome 9 at 119,112,099 bp
  • C to T, chromosome 10 at 82,954,729 bp
  • G to A, chromosome 10 at 130,386,122 bp
  • T to C, chromosome 11 at 68,972,692 bp
  • T to C, chromosome 11 at 69,499,194 bp
  • G to A, chromosome 11 at 70,252,394 bp
  • A to G, chromosome 11 at 100,549,946 bp
  • A to G, chromosome 11 at 104,338,186 bp
  • G to A, chromosome 12 at 4,880,700 bp
  • A to G, chromosome 12 at 55,795,698 bp
  • A to T, chromosome 12 at 69,300,279 bp
  • A to C, chromosome 12 at 99,909,711 bp
  • T to G, chromosome 12 at 104,103,787 bp
  • T to A, chromosome 12 at 110,632,788 bp
  • T to A, chromosome 12 at 118,108,910 bp
  • G to A, chromosome 13 at 19,100,665 bp
  • T to A, chromosome 13 at 22,501,654 bp
  • A to T, chromosome 13 at 38,187,741 bp
  • T to A, chromosome 13 at 56,887,823 bp
  • T to C, chromosome 13 at 67,070,311 bp
  • C to T, chromosome 13 at 99,405,074 bp
  • A to G, chromosome 14 at 47,694,616 bp
  • G to A, chromosome 14 at 50,083,853 bp
  • T to G, chromosome 14 at 117,975,018 bp
  • C to A, chromosome 15 at 31,009,084 bp
  • A to G, chromosome 15 at 59,341,158 bp
  • G to A, chromosome 15 at 77,927,717 bp
  • A to G, chromosome 15 at 79,058,057 bp
  • T to A, chromosome 15 at 85,932,323 bp
  • T to C, chromosome 15 at 98,438,287 bp
  • T to G, chromosome 15 at 103,320,278 bp
  • A to G, chromosome 16 at 18,814,876 bp
  • A to G, chromosome 16 at 45,581,602 bp
  • A to T, chromosome 17 at 13,949,535 bp
  • A to C, chromosome 17 at 28,975,933 bp
  • A to G, chromosome 17 at 33,334,619 bp
  • A to G, chromosome 17 at 88,582,406 bp
  • A to G, chromosome 18 at 37,308,210 bp
  • T to G, chromosome 19 at 10,041,836 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0611 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038800-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.