Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0628Btlr/Mmmh
Stock Number:
038817-MU
Citation ID:
RRID:MMRRC_038817-MU
Other Names:
R0628 (G1), C57BL/6J-MtgxR0628Btlr
Major Collection:

Strain Information

Zic4
Name: zinc finger protein of the cerebellum 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22774
Homologene: 32075
Colgalt2
Name: collagen beta(1-O)galactosyltransferase 2
Synonyms: Glt25d2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269132
Homologene: 22865
Prpf6
Name: pre-mRNA splicing factor 6
Synonyms: 1190003A07Rik, U5-102K, ANT-1, 2610031L17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68879
Homologene: 5368
Gart
Name: phosphoribosylglycinamide formyltransferase
Synonyms: Gaps, Prgs
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14450
HGNC: HGNC:4163
Homologene: 637
Dlg4
Name: discs large MAGUK scaffold protein 4
Synonyms: SAP90, PSD-95, SAP90A, PSD95, Dlgh4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13385
HGNC: HGNC:2903
Homologene: 1047
Snapc3
Name: small nuclear RNA activating complex, polypeptide 3
Synonyms: 5031401C21Rik, 4930558A07Rik, 1810020H02Rik, E030018J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77634
Homologene: 31130
Rc3h2
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Rnf164, D930043C02Rik, 2900024N03Rik, 9430019J22Rik, Mnab
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319817
Homologene: 28276
Reps1
Name: RalBP1 associated Eps domain containing protein
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19707
Homologene: 7515
Sacm1l
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: Sac1p, SAC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83493
VEGA: 9
Homologene: 6320
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235469
Homologene: 17151
Tex9
Name: testis expressed gene 9
Synonyms: tsec-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21778
Homologene: 32072
Copa
Name: coatomer protein complex subunit alpha
Synonyms: xenin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12847
HGNC: HGNC:2230
Homologene: 3218
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Zic2
Name: zinc finger protein of the cerebellum 2
Synonyms: GENA 29, Ku, odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22772
Homologene: 5171
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Lypd8
Name: LY6/PLAUR domain containing 8
Synonyms: 2210415F13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70163
Homologene: 52815
Coq7
Name: demethyl-Q 7
Synonyms: clk-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12850
HGNC: HGNC:2244
Homologene: 6953
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72205
Homologene: 8125
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Slc9b2
Name: solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2
Synonyms: C80638, NHA2, nha-oc, NHE10, Nhedc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 97086
Homologene: 45381
Fam135b
Name: family with sequence similarity 135, member B
Synonyms: A830008O07Rik, 1700010C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70363
VEGA: 15
Homologene: 66605
Camk2d
Name: calcium/calmodulin-dependent protein kinase II, delta
Synonyms: CaMK II, 2810011D23Rik, 8030469K03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 108058
HGNC: HGNC:1462
Homologene: 55561
Kif1a
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Fhip2b
Name: FHF complex subunit HOOK interacting protein 2B
Synonyms: G430067P06Rik, Rai16, Fam160b2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239170
VEGA: 14
Homologene: 23379
Wnk4
Name: WNK lysine deficient protein kinase 4
Synonyms: 2010002J11Rik, Prkwnk4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69847
Homologene: 13020
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Alpk2
Name: alpha-kinase 2
Synonyms: Hak
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225638
Homologene: 50475
Ica1
Name: islet cell autoantigen 1
Synonyms: ICA69, 69kDa
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15893
HGNC: HGNC:5343
Homologene: 7777
Ccdc7b
Name: coiled-coil domain containing 7B
Synonyms: 1700008F21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75453
Homologene: 49919
Mertk
Name: MER proto-oncogene tyrosine kinase
Synonyms: Tyro 12, Nyk, Eyk, Mer, nmf12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17289
HGNC: HGNC:7027
Homologene: 4626
Rpl10a-ps2
Name: ribosomal protein L10A, pseudogene 2
Synonyms: Gm5192
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 382723
Usp3
Name: ubiquitin specific peptidase 3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235441
Homologene: 4766
Gramd1a
Name: GRAM domain containing 1A
Synonyms: 1300003M23Rik, D7Bwg0611e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52857
Homologene: 10843
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242248
Homologene: 9926
Marchf10
Name: membrane associated ring-CH-type finger 10
Synonyms: 4933417C16Rik, Rnf190, OTTMUSG00000002847, March10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 632687
Homologene: 34988
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Zfp692
Name: zinc finger protein 692
Synonyms: Zfp692-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103836
Homologene: 9889
Polrmt
Name: polymerase (RNA) mitochondrial (DNA directed)
Synonyms: 1110018N15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216151
HGNC: HGNC:9200
Homologene: 37996
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 280635
Homologene: 18817
Trappc13
Name: trafficking protein particle complex 13
Synonyms: 2610524F24Rik, 2410002O22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66975
Homologene: 11792
Zfp69
Name: zinc finger protein 69
Synonyms: KRAB2, Zfp63, LOC381549
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381549
Homologene: 45693
Msrb2
Name: methionine sulfoxide reductase B2
Synonyms: 2310050L06Rik, Msrb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76467
Homologene: 56555
Ccdc17
Name: coiled-coil domain containing 17
Synonyms: 1100001F07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622665
Homologene: 77410
Zscan4b
Name: zinc finger and SCAN domain containing 4B
Synonyms: EG665780
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665780
Homologene: 85986
Gm16282
Name: predicted gene 16282
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Iyd
Name: iodotyrosine deiodinase
Synonyms: 0610009A07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70337
Homologene: 12352
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 53,497,105 bp
  • T to C, chromosome 1 at 93,019,883 bp
  • G to T, chromosome 1 at 152,508,561 bp
  • T to C, chromosome 1 at 172,091,025 bp
  • C to A, chromosome 1 at 194,959,217 bp
  • T to A, chromosome 2 at 19,393,280 bp
  • A to T, chromosome 2 at 37,382,052 bp
  • A to T, chromosome 2 at 128,738,313 bp
  • A to G, chromosome 2 at 160,910,879 bp
  • A to C, chromosome 2 at 181,351,881 bp
  • C to T, chromosome 2 at 181,636,048 bp
  • T to C, chromosome 3 at 126,810,624 bp
  • T to A, chromosome 3 at 135,323,775 bp
  • T to A, chromosome 3 at 136,066,390 bp
  • A to T, chromosome 4 at 83,450,160 bp
  • A to T, chromosome 4 at 113,731,069 bp
  • T to A, chromosome 4 at 116,598,548 bp
  • G to A, chromosome 4 at 120,949,425 bp
  • A to G, chromosome 5 at 14,669,538 bp
  • T to A, chromosome 5 at 109,047,731 bp
  • T to C, chromosome 5 at 109,678,576 bp
  • C to T, chromosome 6 at 8,644,256 bp
  • T to C, chromosome 6 at 120,415,239 bp
  • A to T, chromosome 7 at 10,901,463 bp
  • T to C, chromosome 7 at 19,201,554 bp
  • A to G, chromosome 7 at 29,140,210 bp
  • A to G, chromosome 7 at 31,142,624 bp
  • T to C, chromosome 7 at 118,529,644 bp
  • G to A, chromosome 7 at 121,145,650 bp
  • G to A, chromosome 8 at 84,726,526 bp
  • A to G, chromosome 8 at 129,111,017 bp
  • A to G, chromosome 9 at 66,450,881 bp
  • C to T, chromosome 9 at 66,518,444 bp
  • T to C, chromosome 9 at 72,361,948 bp
  • A to T, chromosome 9 at 72,491,951 bp
  • T to A, chromosome 9 at 91,384,117 bp
  • T to A, chromosome 9 at 91,384,119 bp
  • C to G, chromosome 9 at 105,912,450 bp
  • A to G, chromosome 9 at 123,548,995 bp
  • A to T, chromosome 10 at 3,547,127 bp
  • A to G, chromosome 10 at 18,121,093 bp
  • T to A, chromosome 10 at 18,143,040 bp
  • T to C, chromosome 10 at 79,739,145 bp
  • T to G, chromosome 11 at 58,309,623 bp
  • C to T, chromosome 11 at 58,384,673 bp
  • C to T, chromosome 11 at 70,031,784 bp
  • T to C, chromosome 11 at 101,275,023 bp
  • T to A, chromosome 11 at 105,390,160 bp
  • T to A, chromosome 13 at 8,940,922 bp
  • G to C, chromosome 13 at 76,150,729 bp
  • C to T, chromosome 13 at 104,154,916 bp
  • T to C, chromosome 14 at 70,587,721 bp
  • CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC, chromosome 14 at 122,476,364 bp
  • C to T, chromosome 15 at 71,448,656 bp
  • C to T, chromosome 16 at 91,633,902 bp
  • A to C, chromosome 18 at 65,307,296 bp
  • A to G, chromosome 18 at 82,554,617 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0628 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038817-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.