Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0632Btlr/Mmmh
Stock Number:
038821-MU
Citation ID:
RRID:MMRRC_038821-MU
Other Names:
R0632 (G1), C57BL/6J-MtgxR0632Btlr
Major Collection:

Strain Information

Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Slc6a2
Name: solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Synonyms: Slc6a5, NE transporter, NET, norepinephrine transporter
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20538
Homologene: 816
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 34,271,413 bp
  • C to A, chromosome 1 at 65,927,997 bp
  • T to C, chromosome 1 at 136,227,618 bp
  • C to T, chromosome 1 at 138,073,610 bp
  • T to A, chromosome 2 at 29,761,584 bp
  • A to G, chromosome 2 at 120,359,542 bp
  • C to A, chromosome 2 at 127,049,280 bp
  • A to G, chromosome 3 at 19,971,082 bp
  • T to C, chromosome 3 at 20,225,194 bp
  • T to C, chromosome 3 at 129,918,726 bp
  • A to G, chromosome 3 at 153,896,895 bp
  • A to T, chromosome 4 at 28,821,104 bp
  • A to T, chromosome 4 at 41,121,115 bp
  • T to C, chromosome 4 at 47,033,167 bp
  • T to C, chromosome 4 at 104,856,492 bp
  • T to A, chromosome 4 at 129,073,551 bp
  • C to G, chromosome 4 at 130,378,043 bp
  • T to A, chromosome 4 at 130,728,104 bp
  • G to A, chromosome 4 at 144,363,782 bp
  • T to A, chromosome 5 at 3,772,529 bp
  • A to G, chromosome 5 at 61,810,171 bp
  • T to G, chromosome 5 at 67,096,214 bp
  • T to A, chromosome 5 at 89,129,641 bp
  • G to A, chromosome 5 at 122,313,591 bp
  • C to T, chromosome 5 at 134,914,747 bp
  • A to G, chromosome 7 at 27,158,246 bp
  • T to C, chromosome 7 at 42,058,884 bp
  • T to G, chromosome 7 at 43,464,137 bp
  • G to T, chromosome 7 at 43,979,372 bp
  • A to G, chromosome 7 at 64,363,199 bp
  • C to T, chromosome 7 at 68,165,155 bp
  • A to T, chromosome 7 at 98,112,150 bp
  • C to T, chromosome 7 at 100,184,439 bp
  • G to A, chromosome 7 at 102,097,957 bp
  • C to T, chromosome 7 at 102,928,604 bp
  • A to G, chromosome 7 at 104,564,337 bp
  • A to G, chromosome 7 at 104,996,703 bp
  • A to G, chromosome 7 at 119,967,905 bp
  • A to T, chromosome 7 at 130,625,595 bp
  • A to T, chromosome 8 at 81,014,150 bp
  • T to A, chromosome 8 at 92,992,801 bp
  • G to A, chromosome 9 at 7,274,032 bp
  • A to T, chromosome 9 at 7,282,077 bp
  • A to T, chromosome 9 at 45,732,134 bp
  • T to C, chromosome 9 at 67,831,563 bp
  • A to G, chromosome 9 at 90,061,582 bp
  • A to G, chromosome 9 at 104,018,274 bp
  • T to A, chromosome 9 at 119,347,818 bp
  • A to G, chromosome 10 at 7,919,801 bp
  • A to T, chromosome 10 at 26,244,495 bp
  • C to T, chromosome 10 at 92,885,096 bp
  • T to A, chromosome 11 at 4,649,855 bp
  • T to A, chromosome 11 at 29,482,749 bp
  • C to T, chromosome 11 at 34,082,426 bp
  • A to G, chromosome 11 at 55,125,080 bp
  • A to T, chromosome 11 at 102,205,812 bp
  • T to A, chromosome 11 at 102,437,881 bp
  • C to G, chromosome 11 at 118,067,682 bp
  • A to T, chromosome 12 at 52,937,148 bp
  • T to C, chromosome 12 at 59,136,143 bp
  • G to A, chromosome 12 at 65,073,918 bp
  • A to T, chromosome 13 at 19,658,036 bp
  • G to T, chromosome 13 at 22,041,027 bp
  • C to T, chromosome 13 at 33,880,031 bp
  • A to G, chromosome 13 at 91,972,274 bp
  • T to A, chromosome 14 at 64,210,532 bp
  • T to A, chromosome 14 at 79,212,920 bp
  • T to A, chromosome 14 at 106,106,967 bp
  • A to T, chromosome 15 at 76,173,411 bp
  • T to A, chromosome 15 at 91,796,028 bp
  • G to A, chromosome 15 at 98,853,581 bp
  • A to G, chromosome 15 at 99,316,289 bp
  • T to C, chromosome 16 at 29,298,208 bp
  • T to C, chromosome 16 at 34,721,649 bp
  • T to A, chromosome 16 at 56,742,589 bp
  • T to C, chromosome 17 at 32,013,346 bp
  • A to G, chromosome 17 at 53,413,459 bp
  • T to C, chromosome 17 at 56,702,896 bp
  • C to T, chromosome 17 at 67,752,368 bp
  • T to C, chromosome 18 at 20,272,346 bp
  • A to G, chromosome 18 at 58,037,747 bp
  • TAGCCCAGCCCAGCCCAGCCCAGCCCAGCCCAGCC to TAGCCCAGCCCAGCCCAGCCCAGCCCAGCCCAGCCCAGCC, chromosome 19 at 41,949,414 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0632 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038821-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.