Strain Name:
C57BL/6J-MtgxR0632Btlr/Mmmh
Stock Number:
038821-MU
Citation ID:
RRID:MMRRC_038821-MU
Other Names:
R0632 (G1), C57BL/6J-MtgxR0632Btlr
Major Collection:

Gene Information

Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Slc6a2
Name: solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Synonyms: Slc6a5, NE transporter, NET, norepinephrine transporter
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20538
Homologene: 816
Epha7
Name: Eph receptor A7
Synonyms: Ehk3, Mdk1, MDK1, Ebk, Cek11, Hek11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Dst
Name: dystonin
Synonyms: nmf203, ah, bullous pemphigoid antigen 1, nmf339, Bpag1, 2310001O04Rik, bullous pemphigoid antigen 1, BPAG1-n, athetoid, BPAG1, Macf2, A830042E19Rik, Bpag
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Pum1
Name: pumilio RNA-binding family member 1
Synonyms: Pumm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 80912
Homologene: 22830
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15184
Homologene: 3995
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: line 186, hyft, CD221, A330103N21Rik, IGF-1R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Fkbp3
Name: FK506 binding protein 3
Synonyms: 25kDa, FKBP25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 30795
VEGA: 12
HGNC: HGNC:3719
Homologene: 1525
Dscaml1
Name: DS cell adhesion molecule like 1
Synonyms: 4921507G06Rik, 4930435C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 114873
VEGA: 9
Homologene: 79549
Msra
Name: methionine sulfoxide reductase A
Synonyms: 2310045J23Rik, 6530413P12Rik, MSR-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110265
HGNC: HGNC:7377
Homologene: 5812
Ctage5
Name: CTAGE family, member 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Usp38
Name: ubiquitin specific peptidase 38
Synonyms: 4631402N15Rik, 4833420O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74841
Homologene: 12367
Ankib1
Name: ankyrin repeat and IBR domain containing 1
Synonyms: 2310061P20Rik, 4631416I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70797
Homologene: 19076
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57752
Homologene: 5087
Pptc7
Name: PTC7 protein phosphatase homolog
Synonyms: 9130017A15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320717
Homologene: 6100
Mms19
Name: MMS19 cytosolic iron-sulfur assembly component
Synonyms: Mms19, Mms19l, 2610042O15Rik, C86341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72199
Homologene: 41480
Ranbp3
Name: RAN binding protein 3
Synonyms: 2610024N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71810
VEGA: 17
HGNC: HGNC:9850
Homologene: 136516
Ccdc14
Name: coiled-coil domain containing 14
Synonyms: G630039H03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239839
VEGA: 16
Homologene: 32549
Tmem87a
Name: transmembrane protein 87A
Synonyms: A930025J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 211499
Homologene: 9165
Nol6
Name: nucleolar protein family 6 (RNA-associated)
Synonyms: Nrap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230082
Homologene: 41505
Ascc2
Name: activating signal cointegrator 1 complex subunit 2
Synonyms: ASC1p100, 1700011I11Rik, 2610034L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 75452
Homologene: 41774
Ptprc
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: Lyt-4, Ly-5, B220, T200, CD45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: 9330188B09Rik, cI-46, LOC381026, 4921513O20Rik, D630001M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66725
Homologene: 18982
Snrnp40
Name: small nuclear ribonucleoprotein 40 (U5)
Synonyms: Wdr57, 0610009C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66585
Homologene: 3538
Phox2b
Name: paired-like homeobox 2b
Synonyms: Dilp1, Pmx2b, Phox2b, Px2b, NBPhox, GENA 269
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18935
HGNC: HGNC:9143
Homologene: 68371
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: Mtmr15, 6030441H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330554
Homologene: 45598
Atp13a5
Name: ATPase type 13A5
Synonyms: C630015F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 268878
Homologene: 77451
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67313
Homologene: 10103
Ccdc88a
Name: coiled coil domain containing 88A
Synonyms: A430106J12Rik, D130005J21Rik, GIV, C330012F17Rik, C130096N06Rik, HkRP1, Girdin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 108686
Homologene: 41180
Slc4a4
Name: solute carrier family 4 (anion exchanger), member 4
Synonyms: NBC, NBC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54403
Homologene: 55776
Cp
Name: ceruloplasmin
Synonyms: D3Ertd555e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12870
HGNC: HGNC:2295
Homologene: 75
Nphp3
Name: nephronophthisis 3 (adolescent)
Synonyms: D330020E01Rik, pcy, 3632410F03Rik, nephrocystin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74025
HGNC: HGNC:7907
Homologene: 32697
Lcp2
Name: lymphocyte cytosolic protein 2
Synonyms: SLP-76, twm, m1Khoe, SLP76
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16822
HGNC: HGNC:6529
Homologene: 4065
Myo7a
Name: myosin VIIA
Synonyms: USH1B, nmf371, Myo7, polka, Hdb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Akap6
Name: A kinase (PRKA) anchor protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Tab2
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms: Map3k7ip2, A530078N03Rik, 1110030N06Rik, Tak1 binding protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 68652
Homologene: 9019
Msh4
Name: mutS homolog 4
Synonyms: 4930485C04Rik, mMsh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 55993
HGNC: HGNC:7327
Homologene: 1830
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: 2810003K23Rik, Dnahcl1, LOC382552, Dnahc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Gm872
Name: predicted gene 872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Fbn2
Name: fibrillin 2
Synonyms: Sne, Fib-2, sy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Samd3
Name: sterile alpha motif domain containing 3
Synonyms: LOC268288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 268288
VEGA: 10
Homologene: 67991
C8a
Name: complement component 8, alpha polypeptide
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230558
HGNC: HGNC:1352
Homologene: 472
Vmn2r59
Name: vomeronasal 2, receptor 59
Synonyms: EG628444
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 628444
Homologene: 129683
Cpa3
Name: carboxypeptidase A3, mast cell
Synonyms: mast cell carboxypeptidase A, mMC-CPA, MC-CPA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12873
HGNC: HGNC:2298
Homologene: 122138
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: Mll4, Mll2, C430014K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Prpf40b
Name: pre-mRNA processing factor 40B
Synonyms: 2610317D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 54614
Homologene: 81828
Fam171a2
Name: family with sequence similarity 171, member A2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217219
Homologene: 19144
Vsig10l
Name: V-set and immunoglobulin domain containing 10 like
Synonyms: 2210412E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75690
Homologene: 35386
Olfr652
Name: olfactory receptor 652
Synonyms: MOR31-8, GA_x6K02T2PBJ9-7191524-7192471
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259050
Homologene: 17477
Nme8
Name: NME/NM23 family member 8
Synonyms: Txndc3, 1700056P15Rik, Sptrx-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 73412
Homologene: 9593
Dsg1c
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 211924
HGNC: HGNC:3048
Mmp13
Name: matrix metallopeptidase 13
Synonyms: collagenase-1, Mmp1, Collagenase-3, interstitial collagenase, Clg, MMP-13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17386
VEGA: 9
HGNC: HGNC:7159
Homologene: 20548
Klk1b9
Name: kallikrein 1-related peptidase b9
Synonyms: Egfbp-3, Egfbp3, mGk-9, Klk9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13648
HGNC: HGNC:6364
Homologene: 68141
Serpinb6c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms: Spi3C, SPIC, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 97848
HGNC: HGNC:8950
Cldn13
Name: claudin 13
Synonyms: 2500004B14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 57255
Ctsh
Name: cathepsin H
Synonyms: Cat H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13036
HGNC: HGNC:2535
Homologene: 36159
Gm13547
Name: predicted gene 13547
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 433416
Homologene: 136350
Olfr672
Name: olfactory receptor 672
Synonyms: MOR32-4, GA_x6K02T2PBJ9-7625746-7624808
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258755
Homologene: 138317
Gm13119
Name: predicted gene 13119
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433779
Homologene: 83161
Trim52
Name: tripartite motif-containing 52
Synonyms: 4921513B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 212085
Homologene: 79723
G6pd2
Name: glucose-6-phosphate dehydrogenase 2
Synonyms: Gpd2, Gpd-2, G6pdx-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14380
Cyp2t4
Name: cytochrome P450, family 2, subfamily t, polypeptide 4
Synonyms: LOC384724
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384724
Homologene: 76639
Hsf2bp
Name: heat shock transcription factor 2 binding protein
Synonyms: 4932437G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74377
HGNC: HGNC:5226
Homologene: 38263
Rasgrf2
Name: RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms: 6330417G04Rik, Grf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19418
HGNC: HGNC:9876
Homologene: 2169
Crygf
Name: crystallin, gamma F
Synonyms: Cryg-2, 3110001K11Rik, DGcry-2, Len-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12969
Homologene: 128417
Mcub
Name: mitochondrial calcium uniporter dominant negative beta subunit
Synonyms: 9030408N13Rik, Ccdc109b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66815
Homologene: 23056
Anks6
Name: ankyrin repeat and sterile alpha motif domain containing 6
Synonyms: SamCystin, Samd6, b2b1801.1Clo, LOC269533, 2210417J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75691
Homologene: 19545
Rnf19b
Name: ring finger protein 19B
Synonyms: 4930534K13Rik, Ibrdc3, 4930555L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75234
Homologene: 34999
Kcne3
Name: potassium voltage-gated channel, Isk-related subfamily, gene 3
Synonyms: MiRP2, 2210017H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57442
HGNC: HGNC:6243
Homologene: 3994
Art5
Name: ADP-ribosyltransferase 5
Synonyms: Yac-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11875
Homologene: 7231
Olfr572
Name: olfactory receptor 572
Synonyms: GA_x6K02T2PBJ9-5638785-5639741, MOR10-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259093
Homologene: 131142
C2cd4a
Name: C2 calcium-dependent domain containing 4A
Synonyms: Fam148a, EG244911
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244911
VEGA: 9
Homologene: 77917
Acaa1a
Name: acetyl-Coenzyme A acyltransferase 1A
Synonyms: Acaa1, D9Ertd25e, peroxisomal 3-ketoacyl-CoA thiolase, thiolase A, PTL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 113868
HGNC: HGNC:82
Homologene: 37497
Slc36a3
Name: solute carrier family 36 (proton/amino acid symporter), member 3
Synonyms: tramdorin2, TRAMD2, PAT3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 215332
Homologene: 76175
H4c9
Name: H4 clustered histone 9
Synonyms: Hist1h4i
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 319158
Homologene: 134468
Zfp957
Name: zinc finger protein 957
Synonyms: AU017455
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105590
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: Gpr128, 9130020O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239853
Homologene: 13115
Efhb
Name: EF hand domain family, member B
Synonyms: 4921525D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211482
VEGA: 17
Homologene: 16982
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 34,271,413 bp
  • C to A, chromosome 1 at 65,927,997 bp
  • T to C, chromosome 1 at 136,227,618 bp
  • C to T, chromosome 1 at 138,073,610 bp
  • T to A, chromosome 2 at 29,761,584 bp
  • A to G, chromosome 2 at 120,359,542 bp
  • C to A, chromosome 2 at 127,049,280 bp
  • A to G, chromosome 3 at 19,971,082 bp
  • T to C, chromosome 3 at 20,225,194 bp
  • T to C, chromosome 3 at 129,918,726 bp
  • A to G, chromosome 3 at 153,896,895 bp
  • A to T, chromosome 4 at 28,821,104 bp
  • A to T, chromosome 4 at 41,121,115 bp
  • T to C, chromosome 4 at 47,033,167 bp
  • T to C, chromosome 4 at 104,856,492 bp
  • T to A, chromosome 4 at 129,073,551 bp
  • C to G, chromosome 4 at 130,378,043 bp
  • T to A, chromosome 4 at 130,728,104 bp
  • G to A, chromosome 4 at 144,363,782 bp
  • T to A, chromosome 5 at 3,772,529 bp
  • A to G, chromosome 5 at 61,810,171 bp
  • T to G, chromosome 5 at 67,096,214 bp
  • T to A, chromosome 5 at 89,129,641 bp
  • G to A, chromosome 5 at 122,313,591 bp
  • C to T, chromosome 5 at 134,914,747 bp
  • A to G, chromosome 7 at 27,158,246 bp
  • T to C, chromosome 7 at 42,058,884 bp
  • T to G, chromosome 7 at 43,464,137 bp
  • G to T, chromosome 7 at 43,979,372 bp
  • A to G, chromosome 7 at 64,363,199 bp
  • C to T, chromosome 7 at 68,165,155 bp
  • A to T, chromosome 7 at 98,112,150 bp
  • C to T, chromosome 7 at 100,184,439 bp
  • G to A, chromosome 7 at 102,097,957 bp
  • C to T, chromosome 7 at 102,928,604 bp
  • A to G, chromosome 7 at 104,564,337 bp
  • A to G, chromosome 7 at 104,996,703 bp
  • A to G, chromosome 7 at 119,967,905 bp
  • A to T, chromosome 7 at 130,625,595 bp
  • A to T, chromosome 8 at 81,014,150 bp
  • T to A, chromosome 8 at 92,992,801 bp
  • G to A, chromosome 9 at 7,274,032 bp
  • A to T, chromosome 9 at 7,282,077 bp
  • A to T, chromosome 9 at 45,732,134 bp
  • T to C, chromosome 9 at 67,831,563 bp
  • A to G, chromosome 9 at 90,061,582 bp
  • A to G, chromosome 9 at 104,018,274 bp
  • T to A, chromosome 9 at 119,347,818 bp
  • A to G, chromosome 10 at 7,919,801 bp
  • A to T, chromosome 10 at 26,244,495 bp
  • C to T, chromosome 10 at 92,885,096 bp
  • T to A, chromosome 11 at 4,649,855 bp
  • T to A, chromosome 11 at 29,482,749 bp
  • C to T, chromosome 11 at 34,082,426 bp
  • A to G, chromosome 11 at 55,125,080 bp
  • A to T, chromosome 11 at 102,205,812 bp
  • T to A, chromosome 11 at 102,437,881 bp
  • C to G, chromosome 11 at 118,067,682 bp
  • A to T, chromosome 12 at 52,937,148 bp
  • T to C, chromosome 12 at 59,136,143 bp
  • G to A, chromosome 12 at 65,073,918 bp
  • A to T, chromosome 13 at 19,658,036 bp
  • G to T, chromosome 13 at 22,041,027 bp
  • C to T, chromosome 13 at 33,880,031 bp
  • A to G, chromosome 13 at 91,972,274 bp
  • T to A, chromosome 14 at 64,210,532 bp
  • T to A, chromosome 14 at 79,212,920 bp
  • T to A, chromosome 14 at 106,106,967 bp
  • A to T, chromosome 15 at 76,173,411 bp
  • T to A, chromosome 15 at 91,796,028 bp
  • G to A, chromosome 15 at 98,853,581 bp
  • A to G, chromosome 15 at 99,316,289 bp
  • T to C, chromosome 16 at 29,298,208 bp
  • T to C, chromosome 16 at 34,721,649 bp
  • T to A, chromosome 16 at 56,742,589 bp
  • T to C, chromosome 17 at 32,013,346 bp
  • A to G, chromosome 17 at 53,413,459 bp
  • T to C, chromosome 17 at 56,702,896 bp
  • C to T, chromosome 17 at 67,752,368 bp
  • T to C, chromosome 18 at 20,272,346 bp
  • A to G, chromosome 18 at 58,037,747 bp
  • TAGCCCAGCCCAGCCCAGCCCAGCCCAGCCCAGCC to TAGCCCAGCCCAGCCCAGCCCAGCCCAGCCCAGCCCAGCC, chromosome 19 at 41,949,414 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0632 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
038821-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.