Strain Name:
C57BL/6J-MtgxR0655Btlr/Mmmh
Stock Number:
038840-MU
Citation ID:
RRID:MMRRC_038840-MU
Other Names:
R0655 (G1), C57BL/6J-MtgxR0655Btlr
Major Collection:

Strain Information

Mtmr3
Name: myotubularin related protein 3
Synonyms: FYVE-DSP1, 1700092A20Rik, ZFYVE10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Tmed10
Name: transmembrane p24 trafficking protein 10
Synonyms: 1110014C03Rik, p24delta1, p23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68581
VEGA: 12
Homologene: 4972
Mtss1
Name: MTSS I-BAR domain containing 1
Synonyms: MIM, D130001D01Rik, 2310003N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 211401
VEGA: 15
Homologene: 8841
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18983
Homologene: 49011
Abtb3
Name: ankyrin repeat and BTB domain containing 3
Synonyms: 6330404E16Rik, Btbd11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74007
Homologene: 72536
Herc4
Name: hect domain and RLD 4
Synonyms: 4921531D01Rik, 1700056O17Rik, 9530080M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67345
VEGA: 10
Homologene: 56715
Hspa4
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Znfx1
Name: zinc finger, NFX1-type containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98999
Homologene: 10877
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Dstn
Name: destrin
Synonyms: sid23p, ADF, 2610043P17Rik, corn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56431
Homologene: 21362
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Sbno1
Name: strawberry notch 1
Synonyms: sno, 9330180L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243272
Homologene: 10055
Safb
Name: scaffold attachment factor B
Synonyms: 5330423C17Rik, SAFB1, 3110021E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224903
Homologene: 2229
Cct2
Name: chaperonin containing TCP1 subunit 2
Synonyms: Cctb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12461
VEGA: 10
HGNC: HGNC:1615
Homologene: 4696
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329877
Homologene: 23057
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21453
Homologene: 68049
Esf1
Name: ESF1 nucleolar pre-rRNA processing protein homolog
Synonyms: 2610101J03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66580
Homologene: 5717
Cbl
Name: Casitas B-lineage lymphoma
Synonyms: Cbl-2, c-Cbl, 4732447J05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12402
HGNC: HGNC:1541
Homologene: 3802
Slc12a3
Name: solute carrier family 12, member 3
Synonyms: NCC, TSC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20497
Homologene: 287
Taf2
Name: TATA-box binding protein associated factor 2
Synonyms: TAFII150, CIF150, TAF2B, 4732460C16Rik, 150kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319944
VEGA: 15
Homologene: 31137
Atg16l1
Name: autophagy related 16 like 1
Synonyms: APG16L, WDR30, 1500009K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77040
Homologene: 41786
Dgkd
Name: diacylglycerol kinase, delta
Synonyms: DGKdelta, dgkd-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227333
HGNC: HGNC:2851
Homologene: 100054
Htr2b
Name: 5-hydroxytryptamine (serotonin) receptor 2B
Synonyms: 5-HT2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15559
HGNC: HGNC:5294
Homologene: 55492
Abcf1
Name: ATP-binding cassette, sub-family F member 1
Synonyms: Abc50, D17Wsu166e, GCN20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224742
HGNC: HGNC:70
Homologene: 849
Ifitm1
Name: interferon induced transmembrane protein 1
Synonyms: fragilis2, 1110036C17Rik, Mil2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68713
HGNC: HGNC:5412
Homologene: 135938
Cpxm2
Name: carboxypeptidase X, M14 family member 2
Synonyms: 4632435C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 55987
Homologene: 69259
Eif1a
Name: eukaryotic translation initiation factor 1A
Synonyms: Eftu, Ef1a, Eif4c, eIF-1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13664
VEGA: 18
HGNC: HGNC:3252
Homologene: 20364
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Zng1
Name: Zn regulated GTPase metalloprotein activator 1
Synonyms: Zng1, Cbwd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226043
VEGA: 19
Homologene: 6843
Eea1
Name: early endosome antigen 1
Synonyms: B230358H09Rik, ZFYVE2, A430109M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216238
VEGA: 10
HGNC: HGNC:3185
Homologene: 37822
Fem1c
Name: fem 1 homolog c
Synonyms: 3632443A22Rik, 2610312A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240263
Homologene: 10606
Pdgfd
Name: platelet-derived growth factor, D polypeptide
Synonyms: 1110003I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71785
VEGA: 9
Homologene: 11875
Fig4
Name: FIG4 phosphoinositide 5-phosphatase
Synonyms: A530089I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103199
VEGA: 10
Homologene: 6713
Wdr17
Name: WD repeat domain 17
Synonyms: 3010002I12Rik, B230207L18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244484
Homologene: 12460
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329178
Homologene: 122243
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208898
Homologene: 45443
Or8b54
Name: olfactory receptor family 8 subfamily B member 54
Synonyms: GA_x6K02T2PVTD-32478047-32478988, MOR165-8, Olfr921
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258778
VEGA: 9
Homologene: 128138
Klra13-ps
Name: killer cell lectin-like receptor subfamily A, member 13, pseudogene
Synonyms: Ly49M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16631
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: 2300002I04Rik, MUC9, MUC5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Gsdmc2
Name: gasdermin C2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 331063
HGNC: HGNC:7151
Homologene: 69487
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: EG232970, Gm10102
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232970
Homologene: 109375
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234353
Homologene: 87257
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Or1e34
Name: olfactory receptor family 1 subfamily E member 34
Synonyms: GA_x6K02T2P1NL-4043306-4042374, MOR135-8, Olfr394
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 259009
Homologene: 133669
Vmn2r72
Name: vomeronasal 2, receptor 72
Synonyms: EG244114, Vmn2r72-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244114
Homologene: 115466
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244650
Homologene: 71015
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 320277
Homologene: 23371
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319807
Homologene: 14974
Ppp4r4
Name: protein phosphatase 4, regulatory subunit 4
Synonyms: 8430415E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74521
Homologene: 12571
Cd96
Name: CD96 antigen
Synonyms: Tactile, 1700109I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 84544
Homologene: 68489
Matn2
Name: matrilin 2
Synonyms: Crtm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17181
VEGA: 15
HGNC: HGNC:6908
Homologene: 20538
Tectb
Name: tectorin beta
Synonyms: [b]-tectorin, Tctnb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 21684
Homologene: 7568
Cyp3a57
Name: cytochrome P450, family 3, subfamily a, polypeptide 57
Synonyms: EG622127
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 622127
Homologene: 135775
Vmn1r64
Name: vomeronasal 1 receptor 64
Synonyms: V1rd11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404285
Homologene: 41799
Or2ag1b
Name: olfactory receptor family 2 subfamily AG member 1B
Synonyms: GA_x6K02T2PBJ9-9067220-9066273, MOR283-9, Olfr694
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258444
Homologene: 79345
Tmc1
Name: transmembrane channel-like gene family 1
Synonyms: Bth, Beethoven, 4933416G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13409
VEGA: 19
Homologene: 23670
Slfn8
Name: schlafen 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276950
Homologene: 45432
Tnfrsf11a
Name: tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Synonyms: Rank, TRANCE-R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21934
Homologene: 2848
Bmp8b
Name: bone morphogenetic protein 8b
Synonyms: Op3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12164
HGNC: HGNC:1075
Homologene: 130625
Ces1g
Name: carboxylesterase 1G
Synonyms: Ces-1, Ses-1, Ces1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12623
HGNC: HGNC:1863
Homologene: 137354
Vmn1r85
Name: vomeronasal 1 receptor 85
Synonyms: V1rj3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 252909
Homologene: 74338
Pax5
Name: paired box 5
Synonyms: Pax-5, EBB-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18507
HGNC: HGNC:8619
Homologene: 56419
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74691
Homologene: 14311
Cyp4f17
Name: cytochrome P450, family 4, subfamily f, polypeptide 17
Synonyms: EG208285
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 208285
VEGA: 17
Homologene: 129713
Prx
Name: periaxin
Synonyms: L-Periaxin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19153
Homologene: 76542
Scd4
Name: stearoyl-coenzyme A desaturase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 329065
Homologene: 77322
Tssc4
Name: tumor-suppressing subchromosomal transferable fragment 4
Synonyms: ESTM671070
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56844
Homologene: 4169
Oscp1
Name: organic solute carrier partner 1
Synonyms: 6030436A01Rik, 1810007P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230751
Homologene: 71010
Trp53inp2
Name: transformation related protein 53 inducible nuclear protein 2
Synonyms: 1110029F20Rik, Tp53inp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68728
Homologene: 18648
Bcl2l15
Name: BCLl2-like 15
Synonyms: LOC229672, Bfk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229672
Homologene: 19060
Slco1a7
Name: solute carrier organic anion transporter family, member 1a7
Synonyms: Gm5724
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 435927
Cyp2a12
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13085
Homologene: 69128
Vmn2r-ps69
Name: vomeronasal 2, receptor, pseudogene 69
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 670926
Selenoo
Name: selenoprotein O
Synonyms: 1300018J18Rik, Selo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223776
Homologene: 69439
Zbtb9
Name: zinc finger and BTB domain containing 9
Synonyms: 3930402F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 474156
Homologene: 45145
Crisp1
Name: cysteine-rich secretory protein 1
Synonyms: CRISP-1, Aeg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 11571
Homologene: 135665
Rnf138
Name: ring finger protein 138
Synonyms: Trif-d, 2410015A17Rik, 2810480D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 56515
VEGA: 18
Homologene: 9446
Ifit1
Name: interferon-induced protein with tetratricopeptide repeats 1
Synonyms: Ifi56, ISG56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 15957
Homologene: 22462
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 66,503,781 bp
  • A to G, chromosome 1 at 86,110,843 bp
  • T to A, chromosome 1 at 87,766,829 bp
  • C to T, chromosome 1 at 87,936,911 bp
  • G to A, chromosome 1 at 105,808,155 bp
  • T to A, chromosome 2 at 140,148,879 bp
  • T to A, chromosome 2 at 143,938,422 bp
  • G to T, chromosome 2 at 155,386,168 bp
  • T to A, chromosome 2 at 167,056,907 bp
  • C to A, chromosome 3 at 80,732,070 bp
  • T to A, chromosome 3 at 103,832,969 bp
  • A to G, chromosome 4 at 44,537,462 bp
  • G to T, chromosome 4 at 86,844,818 bp
  • T to C, chromosome 4 at 123,115,133 bp
  • T to C, chromosome 4 at 126,058,733 bp
  • T to C, chromosome 5 at 63,791,585 bp
  • C to A, chromosome 5 at 124,376,149 bp
  • A to G, chromosome 5 at 125,300,440 bp
  • T to A, chromosome 5 at 135,242,430 bp
  • C to A, chromosome 5 at 145,370,946 bp
  • T to A, chromosome 5 at 145,370,947 bp
  • A to T, chromosome 6 at 130,291,322 bp
  • C to T, chromosome 6 at 141,723,272 bp
  • G to A, chromosome 7 at 5,884,208 bp
  • A to G, chromosome 7 at 13,084,723 bp
  • A to T, chromosome 7 at 24,624,372 bp
  • A to T, chromosome 7 at 27,036,621 bp
  • T to A, chromosome 7 at 27,517,421 bp
  • T to C, chromosome 7 at 85,308,830 bp
  • A to T, chromosome 7 at 85,738,111 bp
  • A to T, chromosome 7 at 106,689,425 bp
  • G to A, chromosome 7 at 132,054,820 bp
  • C to A, chromosome 7 at 140,969,536 bp
  • A to T, chromosome 7 at 141,863,942 bp
  • A to G, chromosome 7 at 143,070,045 bp
  • CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT to CTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTT, chromosome 8 at 40,500,668 bp
  • A to G, chromosome 8 at 54,649,198 bp
  • A to G, chromosome 8 at 67,963,689 bp
  • T to C, chromosome 8 at 93,305,811 bp
  • T to C, chromosome 8 at 94,343,138 bp
  • A to T, chromosome 8 at 109,895,587 bp
  • A to T, chromosome 9 at 6,288,690 bp
  • C to T, chromosome 9 at 38,775,554 bp
  • G to T, chromosome 9 at 44,158,752 bp
  • T to C, chromosome 9 at 60,872,029 bp
  • G to A, chromosome 9 at 73,930,953 bp
  • T to C, chromosome 10 at 41,285,677 bp
  • T to C, chromosome 10 at 63,273,571 bp
  • A to G, chromosome 10 at 85,645,526 bp
  • A to G, chromosome 10 at 95,995,598 bp
  • A to T, chromosome 10 at 117,061,425 bp
  • C to A, chromosome 11 at 4,488,610 bp
  • T to C, chromosome 11 at 53,269,692 bp
  • T to C, chromosome 11 at 73,887,805 bp
  • A to G, chromosome 11 at 83,003,821 bp
  • T to A, chromosome 12 at 85,343,517 bp
  • T to C, chromosome 12 at 103,606,890 bp
  • A to G, chromosome 12 at 112,040,465 bp
  • T to C, chromosome 13 at 42,167,585 bp
  • T to C, chromosome 15 at 9,626,131 bp
  • T to C, chromosome 15 at 34,345,200 bp
  • G to A, chromosome 15 at 55,038,294 bp
  • C to A, chromosome 15 at 59,081,502 bp
  • C to T, chromosome 15 at 63,827,773 bp
  • T to A, chromosome 15 at 89,095,655 bp
  • A to T, chromosome 16 at 20,193,824 bp
  • T to C, chromosome 16 at 46,099,119 bp
  • T to A, chromosome 17 at 26,974,100 bp
  • T to A, chromosome 17 at 32,524,897 bp
  • G to C, chromosome 17 at 35,957,845 bp
  • A to T, chromosome 17 at 40,305,221 bp
  • T to A, chromosome 17 at 56,597,803 bp
  • C to A, chromosome 17 at 67,816,053 bp
  • T to G, chromosome 18 at 21,010,783 bp
  • G to A, chromosome 18 at 46,505,160 bp
  • G to T, chromosome 18 at 46,608,063 bp
  • A to G, chromosome 18 at 60,832,707 bp
  • C to T, chromosome 19 at 20,799,176 bp
  • T to C, chromosome 19 at 24,953,320 bp
  • T to C, chromosome 19 at 34,647,647 bp
  • A to G, chromosome 19 at 44,338,968 bp
  • G to A, chromosome 19 at 55,189,870 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0655 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038840-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.