Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0676Btlr/Mmmh
Stock Number:
038861-MU
Citation ID:
RRID:MMRRC_038861-MU
Other Names:
R0676 (G1), C57BL/6J-MtgxR0676Btlr
Major Collection:

Strain Information

Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Rbpj
Name: recombination signal binding protein for immunoglobulin kappa J region
Synonyms: CBF1, Igkrsbp, RBP-J kappa, RBPjk, Igkjrb, Rbpsuh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19664
HGNC: HGNC:5724
Homologene: 7511
Luzp1
Name: leucine zipper protein 1
Synonyms: Luzp, 2700072H04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269593
Homologene: 11545
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, 2510009G06Rik, Tip49a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56505
Homologene: 37839
Immt
Name: inner membrane protein, mitochondrial
Synonyms: P87/89, P89, P87, HMP, 1700082C19Rik, D830041H16Rik, mitofilin, Micos60
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76614
HGNC: HGNC:6047
Homologene: 38234
Ric1
Name: RAB6A GEF complex partner 1
Synonyms: C130057E09Rik, C030046E11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226089
Homologene: 13806
Lpin1
Name: lipin 1
Synonyms: Lipin1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14245
VEGA: 12
Homologene: 9266
H2-M5
Name: histocompatibility 2, M region locus 5
Synonyms: H-2M5, D130003B22Rik, CRW2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240095
Homologene: 128812
Mapk9
Name: mitogen-activated protein kinase 9
Synonyms: JNK2, JNK/SAPK alpha, Prkm9, c-Jun N-terminal kinase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26420
HGNC: HGNC:6886
Homologene: 55685
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: P130, NOPP140, 3230402K17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70769
VEGA: 19
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229473
Homologene: 9057
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Klb
Name: klotho beta
Synonyms: betaKlotho
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83379
Homologene: 12820
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: T1 gene, T1, ST2, T1/ST2, Fit-1, DER4, ST2L, St2, St2-rs1, Ly84
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Arhgef25
Name: Rho guanine nucleotide exchange factor 25
Synonyms: 2410008H17Rik, GEFT, D10Ertd610e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52666
VEGA: 10
Homologene: 32691
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: EG638102, V2Rp4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
Slc22a26
Name: solute carrier family 22 (organic cation transporter), member 26
Synonyms: BC014805
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236149
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, 4732458A06Rik, D130016K21Rik, 9430063L05Rik, Usmg4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Cts6
Name: cathepsin 6
Synonyms: 1600022N02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 58518
Homologene: 75165
Lrrk1
Name: leucine-rich repeat kinase 1
Synonyms: D130026O16Rik, C230002E15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233328
Homologene: 23464
Cpb1
Name: carboxypeptidase B1
Synonyms: 2210008M23Rik, 0910001A18Rik, 1810063F02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76703
HGNC: HGNC:2299
Homologene: 68127
Myo1a
Name: myosin IA
Synonyms: BBM-I, brush border myosin 1, Myhl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
B3galnt2
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
Synonyms: A930105D20Rik, D230016N13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97884
VEGA: 13
Homologene: 17595
Gm10845
Name: predicted gene 10845
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 100038734
VEGA: 14
Slc22a23
Name: solute carrier family 22, member 23
Synonyms: 3110004L20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73102
Homologene: 41457
Gabrg3
Name: gamma-aminobutyric acid type A receptor, subunit gamma 3
Synonyms: Gabrg-3, B230362M20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14407
HGNC: HGNC:4088
Homologene: 22444
Sh3tc1
Name: SH3 domain and tetratricopeptide repeats 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231147
Homologene: 10360
BC051076
Name: cDNA sequence BC051076
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243090
Ctnna3
Name: catenin alpha 3
Synonyms: Vr22, Catna3, 4930429L08Rik, alphaT-catenin, catenin (cadherin associated protein), alpha 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216033
HGNC: HGNC:2511
Homologene: 56583
Mrgprb8
Name: MAS-related GPR, member B8
Synonyms: MrgB8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404240
Homologene: 83620
Tmem179b
Name: transmembrane protein 179B
Synonyms: 1500003K22Rik, 0610031L02Rik, 1810059G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67706
VEGA: 19
Homologene: 12177
Tbc1d8b
Name: TBC1 domain family, member 8B
Synonyms: 4921505D17Rik, 9030605E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245638
Homologene: 41196
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • T to C, chromosome 3 at 20,266,533 bp
  • C to T, chromosome 3 at 83,934,815 bp
  • A to C, chromosome 3 at 97,717,097 bp
  • A to G, chromosome 4 at 136,542,685 bp
  • A to T, chromosome 5 at 35,719,114 bp
  • C to T, chromosome 5 at 53,646,048 bp
  • A to T, chromosome 5 at 65,379,055 bp
  • A to G, chromosome 5 at 87,964,657 bp
  • A to G, chromosome 5 at 111,421,034 bp
  • C to A, chromosome 5 at 125,297,214 bp
  • A to G, chromosome 6 at 71,851,844 bp
  • C to A, chromosome 6 at 84,113,336 bp
  • A to G, chromosome 6 at 88,473,200 bp
  • A to T, chromosome 7 at 48,388,664 bp
  • A to T, chromosome 7 at 56,724,421 bp
  • C to T, chromosome 7 at 66,294,981 bp
  • A to C, chromosome 10 at 64,409,261 bp
  • A to G, chromosome 10 at 127,184,010 bp
  • A to G, chromosome 10 at 127,719,880 bp
  • T to C, chromosome 11 at 34,695,236 bp
  • T to C, chromosome 11 at 49,883,156 bp
  • A to T, chromosome 12 at 16,540,979 bp
  • T to C, chromosome 13 at 13,995,793 bp
  • T to C, chromosome 13 at 22,041,106 bp
  • G to A, chromosome 13 at 34,195,479 bp
  • C to T, chromosome 13 at 61,197,484 bp
  • T to A, chromosome 14 at 79,863,204 bp
  • C to T, chromosome 17 at 23,346,264 bp
  • A to G, chromosome 17 at 34,057,275 bp
  • A to G, chromosome 17 at 36,989,142 bp
  • A to T, chromosome 19 at 7,796,144 bp
  • T to C, chromosome 19 at 8,773,369 bp
  • T to C, chromosome 19 at 29,577,647 bp
  • T to A, chromosome 19 at 46,080,089 bp
  • A to G, chromosome X at 139,712,276 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0676 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038861-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.