Strain Name:
Stock Number:
Citation ID:
Other Names:
R0692 (G1), C57BL/6J-MtgxR0692Btlr
Major Collection:

Strain Information

Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20495
Homologene: 286
Name: S1 RNA binding domain 1
Synonyms: D530025C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78586
VEGA: 17
Homologene: 9994
Name: minichromosome maintenance complex component 3 associated protein
Synonyms: GANP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 54387
VEGA: 10
Homologene: 2902
Name: adducin 3 (gamma)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 27360
VEGA: 19
Homologene: 40893
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Name: CDC like kinase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12750
Homologene: 56895
Name: keratin 35
Synonyms: Ha5, Krt1-24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 53617
Homologene: 1715
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 229003
Homologene: 14118
Name: BPI fold containing family B, member 5
Synonyms: BC018465
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228802
Homologene: 64814
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12818
Homologene: 18741
Name: sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
Synonyms: Sema W
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20355
Homologene: 3147
Name: refilin B
Synonyms: cfm, 1500005K14Rik, RefilinB, Fam101b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76566
Homologene: 18809
Name: keratin 81
Synonyms: Krt2-19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 64818
VEGA: 15
Homologene: 55645
Name: potassium voltage-gated channel, subfamily G, member 1
Synonyms: OTTMUSG00000016048
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241794
Homologene: 20515
Name: phosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonyms: cpfl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 110855
VEGA: 19
Homologene: 4521
Name: predicted gene 12735
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Name: plexin C1
Synonyms: vespr, CD232, 2510048K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 54712
Homologene: 4211
Name: SV2 related protein homolog (rat)-like
Synonyms: 9430071P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320590
Homologene: 52168
Name: tripartite motif-containing 41
Synonyms: RINCK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 211007
Homologene: 14140
Name: vomeronasal 1 receptor 23
Synonyms: V1rc24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171197
Homologene: 110825
Name: olfactory receptor family 5 subfamily M member 3B
Synonyms: GA_x6K02T2Q125-47516301-47517233, MOR199-2, Olfr1033
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258571
Homologene: 138314
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 2 at 86,042,172 bp
  • T to A, chromosome 2 at 125,194,162 bp
  • T to C, chromosome 2 at 154,234,696 bp
  • T to A, chromosome 2 at 168,262,763 bp
  • A to G, chromosome 2 at 181,240,881 bp
  • A to T, chromosome 6 at 38,017,196 bp
  • C to A, chromosome 6 at 57,926,125 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 6 at 82,939,530 bp
  • T to C, chromosome 10 at 76,483,169 bp
  • A to G, chromosome 10 at 94,837,500 bp
  • A to G, chromosome 11 at 3,193,726 bp
  • C to T, chromosome 11 at 48,808,250 bp
  • C to T, chromosome 11 at 51,281,328 bp
  • T to C, chromosome 11 at 76,027,453 bp
  • T to C, chromosome 11 at 100,093,070 bp
  • A to T, chromosome 13 at 93,093,849 bp
  • G to C, chromosome 15 at 55,341,738 bp
  • T to C, chromosome 15 at 101,460,172 bp
  • T to C, chromosome 17 at 86,136,460 bp
  • A to T, chromosome 19 at 38,180,250 bp
  • T to A, chromosome 19 at 53,216,952 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0692 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038877-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.