Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0744Btlr/Mmmh
Stock Number:
038925-MU
Citation ID:
RRID:MMRRC_038925-MU
Other Names:
R0744 (G1), C57BL/6J-MtgxR0744Btlr
Major Collection:

Strain Information

Slc25a1tm1a(EUCOMM)Wtsi
Name: solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1; targeted mutation 1a, Wellcome Trust Sanger Institute
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Pzp2
Name: PZP alpha-2-macroglobulin like 2
Synonyms: Pzp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 22,427,459 bp
  • A to G, chromosome 1 at 28,777,821 bp
  • A to T, chromosome 1 at 85,699,744 bp
  • T to A, chromosome 1 at 127,802,394 bp
  • A to G, chromosome 1 at 167,373,805 bp
  • T to A, chromosome 1 at 184,921,608 bp
  • C to T, chromosome 1 at 188,814,406 bp
  • GCCACCA to GCCA, chromosome 2 at 52,110,324 bp
  • T to C, chromosome 2 at 91,036,808 bp
  • T to C, chromosome 2 at 125,314,814 bp
  • T to C, chromosome 2 at 130,151,761 bp
  • T to C, chromosome 2 at 164,070,976 bp
  • TGAGGAGGAGGAGGAGGAGG to TGAGGAGGAGGAGGAGG, chromosome 2 at 181,797,505 bp
  • A to T, chromosome 3 at 3,651,629 bp
  • T to A, chromosome 3 at 54,714,701 bp
  • T to A, chromosome 3 at 58,636,122 bp
  • C to A, chromosome 3 at 89,230,328 bp
  • T to C, chromosome 3 at 154,265,474 bp
  • A to G, chromosome 4 at 114,580,322 bp
  • A to G, chromosome 4 at 128,884,215 bp
  • A to T, chromosome 4 at 143,698,486 bp
  • A to T, chromosome 5 at 73,089,081 bp
  • T to C, chromosome 5 at 90,946,942 bp
  • T to A, chromosome 5 at 108,673,523 bp
  • T to A, chromosome 5 at 111,231,081 bp
  • C to T, chromosome 5 at 113,279,184 bp
  • T to C, chromosome 5 at 123,630,721 bp
  • T to A, chromosome 5 at 129,902,272 bp
  • T to A, chromosome 5 at 131,150,916 bp
  • C to T, chromosome 5 at 135,132,475 bp
  • T to A, chromosome 5 at 137,365,667 bp
  • T to A, chromosome 5 at 144,266,641 bp
  • T to C, chromosome 6 at 3,372,725 bp
  • T to G, chromosome 6 at 121,302,867 bp
  • A to G, chromosome 6 at 128,516,195 bp
  • T to G, chromosome 6 at 140,642,364 bp
  • T to C, chromosome 7 at 41,376,859 bp
  • T to C, chromosome 7 at 56,206,036 bp
  • T to C, chromosome 7 at 103,740,925 bp
  • T to C, chromosome 7 at 108,564,998 bp
  • T to C, chromosome 7 at 119,777,100 bp
  • G to T, chromosome 8 at 3,853,205 bp
  • T to A, chromosome 8 at 13,172,654 bp
  • A to T, chromosome 8 at 15,132,924 bp
  • A to T, chromosome 8 at 27,344,720 bp
  • A to G, chromosome 8 at 33,295,006 bp
  • A to T, chromosome 8 at 45,087,937 bp
  • A to G, chromosome 8 at 70,393,013 bp
  • A to C, chromosome 8 at 71,683,978 bp
  • G to A, chromosome 9 at 20,499,799 bp
  • A to T, chromosome 9 at 38,472,785 bp
  • A to T, chromosome 9 at 108,404,801 bp
  • T to C, chromosome 10 at 7,907,581 bp
  • C to A, chromosome 10 at 19,002,949 bp
  • T to C, chromosome 10 at 22,702,016 bp
  • T to C, chromosome 10 at 50,845,666 bp
  • T to C, chromosome 10 at 81,588,947 bp
  • T to C, chromosome 10 at 87,165,069 bp
  • T to A, chromosome 11 at 28,583,296 bp
  • T to A, chromosome 11 at 75,165,801 bp
  • C to T, chromosome 11 at 84,024,305 bp
  • C to A, chromosome 11 at 107,110,812 bp
  • A to T, chromosome 11 at 110,040,564 bp
  • A to C, chromosome 12 at 61,839,668 bp
  • G to A, chromosome 13 at 24,863,580 bp
  • C to A, chromosome 13 at 55,003,933 bp
  • A to G, chromosome 13 at 74,316,324 bp
  • A to T, chromosome 13 at 100,035,825 bp
  • C to G, chromosome 13 at 102,737,387 bp
  • A to T, chromosome 14 at 30,941,555 bp
  • T to C, chromosome 14 at 52,349,378 bp
  • A to G, chromosome 15 at 6,764,278 bp
  • T to C, chromosome 15 at 31,480,291 bp
  • C to T, chromosome 15 at 76,693,669 bp
  • G to A, chromosome 15 at 97,761,585 bp
  • T to C, chromosome 15 at 99,243,449 bp
  • T to C, chromosome 16 at 4,419,271 bp
  • T to A, chromosome 16 at 17,927,436 bp
  • T to C, chromosome 16 at 19,883,872 bp
  • T to A, chromosome 16 at 32,475,849 bp
  • A to G, chromosome 16 at 33,900,583 bp
  • A to G, chromosome 16 at 37,878,573 bp
  • A to G, chromosome 16 at 48,959,675 bp
  • T to A, chromosome 17 at 26,203,318 bp
  • A to G, chromosome 18 at 22,516,040 bp
  • G to T, chromosome 18 at 32,939,454 bp
  • T to C, chromosome 18 at 49,833,148 bp
  • T to C, chromosome 18 at 60,845,832 bp
  • T to C, chromosome 18 at 69,987,041 bp
  • A to C, chromosome 18 at 89,207,020 bp
  • A to G, chromosome 19 at 7,285,824 bp
  • T to C, chromosome 19 at 8,116,833 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0744 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038925-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.