Strain Name:
C57BL/6J-MtgxR0744Btlr/Mmmh
Stock Number:
038925-MU
Citation ID:
RRID:MMRRC_038925-MU
Other Names:
R0744 (G1), C57BL/6J-MtgxR0744Btlr
Major Collection:

Strain Information

Slc25a1tm1a(EUCOMM)Wtsi
Name: solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1; targeted mutation 1a, Wellcome Trust Sanger Institute
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 22427
Homologene: 6659
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11287
Homologene: 104112
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 78757
VEGA: 15
Homologene: 34317
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 52850
Homologene: 64485
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 72313
Homologene: 103956
Mark2
Name: MAP/microtubule affinity regulating kinase 2
Synonyms: Par-1, Emk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 13728
HGNC: HGNC:3332
Homologene: 69013
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 328329
Homologene: 42094
Aebp2
Name: AE binding protein 2
Synonyms: B230313N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11569
Homologene: 40690
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 77987
VEGA: 10
Homologene: 4973
Supt20
Name: SPT20 SAGA complex component
Synonyms: p38 interacting protein, p38IP, D3Ertd300e, Fam48a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 56790
Homologene: 134155
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 21453
Homologene: 68049
Rapsn
Name: receptor-associated protein of the synapse
Synonyms: rapsyn, Raps, 43kDa acetylcholine receptor-associated protein, Nraps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 19400
HGNC: HGNC:9863
Homologene: 3708
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 51869
Homologene: 41231
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 544971
Homologene: 34582
Myt1
Name: myelin transcription factor 1
Synonyms: NZF-2b, NZF-2a, Nzf2, Nztf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Unc5a
Name: unc-5 netrin receptor A
Synonyms: Unc5h1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 107448
Homologene: 41474
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224170
Homologene: 8771
Jak3
Name: Janus kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 16453
HGNC: HGNC:6193
Homologene: 181
Synrg
Name: synergin, gamma
Synonyms: L71-5, Ap1gbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217030
HGNC: HGNC:557
Homologene: 105680
Zfp266
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 77519
Homologene: 105676
Crtc1
Name: CREB regulated transcription coactivator 1
Synonyms: Mect1, TORC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 382056
Homologene: 41607
Marchf6
Name: membrane associated ring-CH-type finger 6
Synonyms: F830029L24Rik, March6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223455
VEGA: 15
Homologene: 4301
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 211961
Homologene: 19371
Rapgef3
Name: Rap guanine nucleotide exchange factor (GEF) 3
Synonyms: 2310016P22Rik, 9330170P05Rik, Epac1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223864
Homologene: 21231
Mgst3
Name: microsomal glutathione S-transferase 3
Synonyms: GST-III, 2010306B17Rik, 2010012L10Rik, 2700004G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 66447
HGNC: HGNC:7064
Homologene: 3327
Mthfd2l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Synonyms: C630010D07Rik, 1110019K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 665563
Homologene: 28295
Ccnt2
Name: cyclin T2
Synonyms: 2900041I18Rik, CycT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 72949
HGNC: HGNC:1600
Homologene: 14043
Zbed5
Name: zinc finger BED-type containing 5
Synonyms: 2410018M08Rik, Zbed5, Chchd2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 71970
Homologene: 84838
Tab2
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms: Tak1 binding protein 2, 1110030N06Rik, A530078N03Rik, Map3k7ip2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 68652
Homologene: 9019
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22283
Homologene: 66151
Mlxipl
Name: MLX interacting protein-like
Synonyms: WS-bHLH, ChREBP, Wbscr14, bHLHd14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 58805
Homologene: 32507
Or8b1c
Name: olfactory receptor family 8 subfamily B member 1C
Synonyms: GA_x6K02T2PVTD-32165709-32166641, MOR167-1, Olfr905
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258800
VEGA: 9
Homologene: 110524
D130043K22Rik
Name: RIKEN cDNA D130043K22 gene
Synonyms: Kiaa0319
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 210108
Homologene: 8878
Slc44a5
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 242259
Homologene: 72094
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116837
Homologene: 128399
Tnfaip3
Name: tumor necrosis factor, alpha-induced protein 3
Synonyms: A20, zinc finger protein A20, Tnfip3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 21929
Homologene: 4582
Ppp1r16a
Name: protein phosphatase 1, regulatory subunit 16A
Synonyms: 2900084E10Rik, Mypt3, R75527
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 73062
Homologene: 13161
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Baiap2l1
Name: BAI1-associated protein 2-like 1
Synonyms: 1300006M19Rik, IRTKS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 66898
Homologene: 23123
Myom2
Name: myomesin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 545527
Homologene: 65043
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: inter-alpha (globulin) inhibitor, H1 polypeptide, Intin1, Itih-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Lamp1
Name: lysosomal-associated membrane protein 1
Synonyms: CD107a, Lamp-1, Perk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 16783
HGNC: HGNC:6499
Homologene: 4061
Slc51a
Name: solute carrier family 51, alpha subunit
Synonyms: OSTalpha, D630035O19Rik, Osta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 106407
Homologene: 44941
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Sp100
Name: nuclear antigen Sp100
Synonyms: A430075G10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20684
Homologene: 86761
Pramel23
Name: PRAME like 23
Synonyms: Gm13089
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 277667
Hnf4g
Name: hepatocyte nuclear factor 4, gamma
Synonyms: NR2A2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 30942
HGNC: HGNC:5026
Homologene: 37886
Cd209e
Name: CD209e antigen
Synonyms: SIGNR4, mSIGNR4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 170780
HGNC: HGNC:1641
Homologene: 128353
Mcrs1
Name: microspherule protein 1
Synonyms: P78, ICP22BP, MSP58, C78274
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 51812
VEGA: 15
HGNC: HGNC:6960
Homologene: 4622
Hic1
Name: hypermethylated in cancer 1
Synonyms: HIC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 15248
HGNC: HGNC:4909
Homologene: 4740
Iho1
Name: interactor of HORMAD1 1
Synonyms: Iho1, Ccdc36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 434438
Homologene: 52256
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 209683
Homologene: 41023
Mtnr1a
Name: melatonin receptor 1A
Synonyms: MelR, Mel1a receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 17773
HGNC: HGNC:7463
Homologene: 21207
Cd226
Name: CD226 antigen
Synonyms: TLiSA1, DNAM-1, DNAM1, Pta1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225825
Homologene: 4787
Tgm6
Name: transglutaminase 6
Synonyms: TGM3L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241636
Homologene: 27970
Trim62
Name: tripartite motif-containing 62
Synonyms: 6330414G21Rik, Dear1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 67525
Homologene: 10071
Slc6a13
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms: Gabt3, Gat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 14412
Homologene: 9592
Camk4
Name: calcium/calmodulin-dependent protein kinase IV
Synonyms: Ca2+/calmodulin-dependent protein kinase type IV/Gr, CaMKIV/Gr, CaMKIV, A430110E23Rik, D18Bwg0362e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 12326
VEGA: 18
HGNC: HGNC:1464
Homologene: 100780
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 56430
Homologene: 74455
1700113H08Rik
Name: RIKEN cDNA 1700113H08 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 76640
Homologene: 45695
Mark1
Name: MAP/microtubule affinity regulating kinase 1
Synonyms: Emk3, B930025N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226778
HGNC: HGNC:6896
Homologene: 49552
Or56b1b
Name: olfactory receptor family 56 subfamily B member 1B
Synonyms: GA_x6K02T2PBJ9-10895499-10894543, MOR40-7P, MOR40-15, Olfr504
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258163
Homologene: 17189
Gm597
Name: predicted gene 597
Synonyms: LOC210962
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 210962
Ccdc85a
Name: coiled-coil domain containing 85A
Synonyms: E030025D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216613
Homologene: 65605
Pdcd6
Name: programmed cell death 6
Synonyms: PS2, MA-3, Alg2, alg-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 18570
VEGA: 13
HGNC: HGNC:8765
Homologene: 7880
Itgb5
Name: integrin beta 5
Synonyms: [b]5B, [b]5A, [b]-5, beta-5, beta5, [b]5, ESTM23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 16419
HGNC: HGNC:6160
Homologene: 20511
Tle2
Name: transducin-like enhancer of split 2
Synonyms: Grg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 21886
Homologene: 20693
Lrfn5
Name: leucine rich repeat and fibronectin type III domain containing 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238205
Homologene: 17582
Acsm3
Name: acyl-CoA synthetase medium-chain family member 3
Synonyms: Sa, Sah
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20216
Homologene: 74559
Tex24
Name: testis expressed gene 24
Synonyms: TESF-1, 1700108N07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 541463
Slc2a12
Name: solute carrier family 2 (facilitated glucose transporter), member 12
Synonyms: Glut12, GLUT-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 353169
Homologene: 59263
Ephb4
Name: Eph receptor B4
Synonyms: MDK2, Myk1, Htk, Tyro11, b2b2412Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Trabd2b
Name: TraB domain containing 2B
Synonyms: Gm12824, Hkat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 666048
Homologene: 85034
Muc1
Name: mucin 1, transmembrane
Synonyms: EMA, CD227, Muc-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 17829
HGNC: HGNC:7508
Homologene: 137248
Rab27b
Name: RAB27B, member RAS oncogene family
Synonyms: 2310021G14Rik, B130064M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 80718
HGNC: HGNC:9767
Homologene: 20879
Tomm34
Name: translocase of outer mitochondrial membrane 34
Synonyms: TOM34, 2610100K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 67145
Homologene: 4956
Slc26a1
Name: solute carrier family 26 (sulfate transporter), member 1
Synonyms: Sat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231583
Homologene: 32539
Galnt17
Name: polypeptide N-acetylgalactosaminyltransferase 17
Synonyms: E330012B09Rik, Gcap8, Galnt19, Wbscr17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 212996
Homologene: 49707
AI987944
Name: expressed sequence AI987944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233168
Or52ae9
Name: olfactory receptor family 52 subfamily AE member 9
Synonyms: GA_x6K02T2PBJ9-6466772-6465828, MOR26-2, Olfr629
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258818
Homologene: 105159
Or10g3b
Name: olfactory receptor family 10 subfamily G member 3B
Synonyms: GA_x6K02T2RJGY-644134-645075, MOR223-7P, MOR223-10, Olfr1513
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 258008
HGNC: HGNC:8171
Homologene: 79404
A930003A15Rik
Name: RIKEN cDNA A930003A15 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 68162
VEGA: 16
Lrrc58
Name: leucine rich repeat containing 58
Synonyms: C330018J07Rik, 1810012N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 320184
Homologene: 14598
Slc22a28
Name: solute carrier family 22, member 28
Synonyms: Gm5631
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 434674
VEGA: 19
Homologene: 77136
Slc25a1
Name: solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
Synonyms: Dgsj, Slc20a3, 1300019P08Rik, 2610100G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 13358
Homologene: 4362
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 22,427,459 bp
  • A to G, chromosome 1 at 28,777,821 bp
  • A to T, chromosome 1 at 85,699,744 bp
  • T to A, chromosome 1 at 127,802,394 bp
  • A to G, chromosome 1 at 167,373,805 bp
  • T to A, chromosome 1 at 184,921,608 bp
  • C to T, chromosome 1 at 188,814,406 bp
  • GCCACCA to GCCA, chromosome 2 at 52,110,324 bp
  • T to C, chromosome 2 at 91,036,808 bp
  • T to C, chromosome 2 at 125,314,814 bp
  • T to C, chromosome 2 at 130,151,761 bp
  • T to C, chromosome 2 at 164,070,976 bp
  • TGAGGAGGAGGAGGAGGAGG to TGAGGAGGAGGAGGAGG, chromosome 2 at 181,797,505 bp
  • A to T, chromosome 3 at 3,651,629 bp
  • T to A, chromosome 3 at 54,714,701 bp
  • T to A, chromosome 3 at 58,636,122 bp
  • C to A, chromosome 3 at 89,230,328 bp
  • T to C, chromosome 3 at 154,265,474 bp
  • A to G, chromosome 4 at 114,580,322 bp
  • A to G, chromosome 4 at 128,884,215 bp
  • A to T, chromosome 4 at 143,698,486 bp
  • A to T, chromosome 5 at 73,089,081 bp
  • T to C, chromosome 5 at 90,946,942 bp
  • T to A, chromosome 5 at 108,673,523 bp
  • T to A, chromosome 5 at 111,231,081 bp
  • C to T, chromosome 5 at 113,279,184 bp
  • T to C, chromosome 5 at 123,630,721 bp
  • T to A, chromosome 5 at 129,902,272 bp
  • T to A, chromosome 5 at 131,150,916 bp
  • C to T, chromosome 5 at 135,132,475 bp
  • T to A, chromosome 5 at 137,365,667 bp
  • T to A, chromosome 5 at 144,266,641 bp
  • T to C, chromosome 6 at 3,372,725 bp
  • T to G, chromosome 6 at 121,302,867 bp
  • A to G, chromosome 6 at 128,516,195 bp
  • T to G, chromosome 6 at 140,642,364 bp
  • T to C, chromosome 7 at 41,376,859 bp
  • T to C, chromosome 7 at 56,206,036 bp
  • T to C, chromosome 7 at 103,740,925 bp
  • T to C, chromosome 7 at 108,564,998 bp
  • T to C, chromosome 7 at 119,777,100 bp
  • G to T, chromosome 8 at 3,853,205 bp
  • T to A, chromosome 8 at 13,172,654 bp
  • A to T, chromosome 8 at 15,132,924 bp
  • A to T, chromosome 8 at 27,344,720 bp
  • A to G, chromosome 8 at 33,295,006 bp
  • A to T, chromosome 8 at 45,087,937 bp
  • A to G, chromosome 8 at 70,393,013 bp
  • A to C, chromosome 8 at 71,683,978 bp
  • G to A, chromosome 9 at 20,499,799 bp
  • A to T, chromosome 9 at 38,472,785 bp
  • A to T, chromosome 9 at 108,404,801 bp
  • T to C, chromosome 10 at 7,907,581 bp
  • C to A, chromosome 10 at 19,002,949 bp
  • T to C, chromosome 10 at 22,702,016 bp
  • T to C, chromosome 10 at 50,845,666 bp
  • T to C, chromosome 10 at 81,588,947 bp
  • T to C, chromosome 10 at 87,165,069 bp
  • T to A, chromosome 11 at 28,583,296 bp
  • T to A, chromosome 11 at 75,165,801 bp
  • C to T, chromosome 11 at 84,024,305 bp
  • C to A, chromosome 11 at 107,110,812 bp
  • A to T, chromosome 11 at 110,040,564 bp
  • A to C, chromosome 12 at 61,839,668 bp
  • G to A, chromosome 13 at 24,863,580 bp
  • C to A, chromosome 13 at 55,003,933 bp
  • A to G, chromosome 13 at 74,316,324 bp
  • A to T, chromosome 13 at 100,035,825 bp
  • C to G, chromosome 13 at 102,737,387 bp
  • A to T, chromosome 14 at 30,941,555 bp
  • T to C, chromosome 14 at 52,349,378 bp
  • A to G, chromosome 15 at 6,764,278 bp
  • T to C, chromosome 15 at 31,480,291 bp
  • C to T, chromosome 15 at 76,693,669 bp
  • G to A, chromosome 15 at 97,761,585 bp
  • T to C, chromosome 15 at 99,243,449 bp
  • T to C, chromosome 16 at 4,419,271 bp
  • T to A, chromosome 16 at 17,927,436 bp
  • T to C, chromosome 16 at 19,883,872 bp
  • T to A, chromosome 16 at 32,475,849 bp
  • A to G, chromosome 16 at 33,900,583 bp
  • A to G, chromosome 16 at 37,878,573 bp
  • A to G, chromosome 16 at 48,959,675 bp
  • T to A, chromosome 17 at 26,203,318 bp
  • A to G, chromosome 18 at 22,516,040 bp
  • G to T, chromosome 18 at 32,939,454 bp
  • T to C, chromosome 18 at 49,833,148 bp
  • T to C, chromosome 18 at 60,845,832 bp
  • T to C, chromosome 18 at 69,987,041 bp
  • A to C, chromosome 18 at 89,207,020 bp
  • A to G, chromosome 19 at 7,285,824 bp
  • T to C, chromosome 19 at 8,116,833 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0744 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038925-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.