Strain Name:
Stock Number:
Citation ID:
Other Names:
R0744 (G1), C57BL/6J-MtgxR0744Btlr
Major Collection:

Gene Information

Name: solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1; targeted mutation 1a, Wellcome Trust Sanger Institute
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 22427
Homologene: 6659
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11287
Homologene: 104112
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 11515
Homologene: 868
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 50782
Homologene: 77719
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 4921505C17Rik, 6030405M08Rik, D530039E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 78757
VEGA: 15
Homologene: 34317
Name: small G protein signaling modulator 1
Synonyms: Rutbc2, D5Bwg1524e, 2410098H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 52850
Homologene: 64485
Name: FRY like transcription coactivator
Synonyms: 9030227G01Rik, 2510002A14Rik, 2310004H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 72313
Homologene: 103956
Name: MAP/microtubule affinity regulating kinase 2
Synonyms: Par-1, Emk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 13728
Homologene: 69013
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 328329
Homologene: 42094
Name: AE binding protein 2
Synonyms: B230313N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11569
Homologene: 40690
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 77987
VEGA: 10
Homologene: 4973
Name: SPT20 SAGA complex component
Synonyms: p38 interacting protein, D3Ertd300e, Fam48a, p38IP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 56790
Homologene: 134155
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D15F32S1h, D7H15F32S1, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 15204
Homologene: 3430
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 240283
Homologene: 21136
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 207165
Homologene: 114397
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 21453
Homologene: 68049
Name: receptor-associated protein of the synapse
Synonyms: Raps, Nraps, rapsyn, 43kDa acetylcholine receptor-associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 19400
Homologene: 3708
Name: replication timing regulatory factor 1
Synonyms: D2Ertd145e, 5730435J01Rik, 6530403D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 51869
Homologene: 41231
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFC5, G630013P12Rik, Tfnr, B130055N23Rik, TFIIIB150, TFIIIB90, TAF3B1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 544971
Homologene: 34582
Name: myelin transcription factor 1
Synonyms: NZF-2b, Nzf2, Nztf2, NZF-2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 17932
Homologene: 3332
Name: unc-5 netrin receptor A
Synonyms: Unc5h1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 107448
Homologene: 41474
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224170
Homologene: 8771
Name: Janus kinase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 16453
Homologene: 181
Name: synergin, gamma
Synonyms: L71-5, Ap1gbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217030
Homologene: 105680
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 77519
Homologene: 105676
Name: CREB regulated transcription coactivator 1
Synonyms: Mect1, TORC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 382056
Homologene: 41607
Name: membrane associated ring-CH-type finger 6
Synonyms: F830029L24Rik, March6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223455
VEGA: 15
Homologene: 4301
Name: additional sex combs like 3, transcriptional regulator
Synonyms: C230079D11Rik, LOC381127, D930044O18Rik, D430002O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 211961
Homologene: 19371
Name: Rap guanine nucleotide exchange factor (GEF) 3
Synonyms: 2310016P22Rik, 9330170P05Rik, Epac1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223864
Homologene: 21231
Name: microsomal glutathione S-transferase 3
Synonyms: 2010306B17Rik, GST-III, 2010012L10Rik, 2700004G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 66447
Homologene: 3327
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Synonyms: C630010D07Rik, 1110019K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 665563
Homologene: 28295
Name: cyclin T2
Synonyms: CycT2, 2900041I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 72949
Homologene: 14043
Name: zinc finger, BED type containing 5
Synonyms: 2410018M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 71970
Homologene: 84838
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms: 1110030N06Rik, Tak1 binding protein 2, Map3k7ip2, A530078N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 68652
Homologene: 9019
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14118
Homologene: 30958
Name: usherin
Synonyms: Ush2a, LOC269160, MUSH2A, A930037M10Rik, A930011D15Rik, Ushrn, LOC381317
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22283
Homologene: 66151
Name: MLX interacting protein-like
Synonyms: WS-bHLH, ChREBP, Wbscr14, bHLHd14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 58805
Homologene: 32507
Name: olfactory receptor 905
Synonyms: GA_x6K02T2PVTD-32165709-32166641, MOR167-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258800
Homologene: 110524
Name: RIKEN cDNA D130043K22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 210108
Homologene: 8878
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 242259
Homologene: 72094
Name: regulating synaptic membrane exocytosis 1
Synonyms: C030033M19Rik, RIM1alpha, RIM1, RIM1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116837
Homologene: 128399
Name: tumor necrosis factor, alpha-induced protein 3
Synonyms: Tnfip3, A20, zinc finger protein A20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 21929
Homologene: 4582
Name: protein phosphatase 1, regulatory subunit 16A
Synonyms: R75527, Mypt3, 2900084E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 73062
Homologene: 13161
Name: ATP-binding cassette, sub-family A (ABC1), member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217258
Homologene: 131160
Name: BAI1-associated protein 2-like 1
Synonyms: IRTKS, 1300006M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 66898
Homologene: 23123
Name: myomesin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 17930
Homologene: 2953
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 545527
Homologene: 65043
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: Intin1, inter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 16424
Homologene: 1667
Name: lysosomal-associated membrane protein 1
Synonyms: CD107a, Lamp-1, Perk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 16783
Homologene: 4061
Name: solute carrier family 51, alpha subunit
Synonyms: Osta, D630035O19Rik, OSTalpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 106407
Homologene: 44941
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 209086
Homologene: 7707
Name: nuclear antigen Sp100
Synonyms: A430075G10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20684
Homologene: 86761
Name: predicted gene 13089
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 277667
Name: hepatocyte nuclear factor 4, gamma
Synonyms: NR2A2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 30942
Homologene: 37886
Name: CD209e antigen
Synonyms: mSIGNR4, SIGNR4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 170780
Homologene: 128353
Name: microspherule protein 1
Synonyms: ICP22BP, C78274, P78, MSP58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 51812
VEGA: 15
Homologene: 4622
Name: hypermethylated in cancer 1
Synonyms: HIC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 15248
Homologene: 4740
Name: coiled-coil domain containing 36
Synonyms: Iho1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 434438
Homologene: 52256
Name: tetratricopeptide repeat domain 28
Synonyms: TPRBK, 2310015L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 209683
Homologene: 41023
Name: melatonin receptor 1A
Synonyms: MelR, Mel1a receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 17773
Homologene: 21207
Name: CD226 antigen
Synonyms: TLiSA1, DNAM-1, DNAM1, Pta1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225825
Homologene: 4787
Name: transglutaminase 6
Synonyms: TGM3L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241636
Homologene: 27970
Name: tripartite motif-containing 62
Synonyms: Dear1, 6330414G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 67525
Homologene: 10071
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms: Gabt3, Gat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 14412
Homologene: 9592
Name: calcium/calmodulin-dependent protein kinase IV
Synonyms: Ca2+/calmodulin-dependent protein kinase type IV/Gr, D18Bwg0362e, A430110E23Rik, CaMKIV, CaMKIV/Gr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 12326
VEGA: 18
Homologene: 100780
Name: CAP-GLY domain containing linker protein 1
Synonyms: 4631429H07Rik, Clip 170, restin, Clip50, cytoplasmic linker protein 50, CLIP-170, Rsn, 1110007I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 56430
Homologene: 74455
Name: RIKEN cDNA 1700113H08 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 76640
Homologene: 45695
Name: MAP/microtubule affinity regulating kinase 1
Synonyms: B930025N23Rik, Emk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226778
Homologene: 49552
Name: olfactory receptor 504
Synonyms: GA_x6K02T2PBJ9-10895499-10894543, MOR40-15, MOR40-7P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258163
Homologene: 17189
Name: predicted gene 597
Synonyms: LOC210962
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 210962
Name: coiled-coil domain containing 85A
Synonyms: E030025D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216613
Homologene: 65605
Name: programmed cell death 6
Synonyms: alg-2, Alg2, MA-3, PS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 18570
VEGA: 13
Homologene: 7880
Name: integrin beta 5
Synonyms: beta-5, [b]5A, [b]-5, [b]5B, [b]5, ESTM23, beta5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 16419
Homologene: 20511
Name: transducin-like enhancer of split 2
Synonyms: Grg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 21886
Homologene: 20693
Name: leucine rich repeat and fibronectin type III domain containing 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238205
Homologene: 17582
Name: acyl-CoA synthetase medium-chain family member 3
Synonyms: Sah, Sa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20216
Homologene: 74559
Name: testis expressed gene 24
Synonyms: 1700108N07Rik, TESF-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 541463
Name: solute carrier family 2 (facilitated glucose transporter), member 12
Synonyms: GLUT-12, Glut12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 353169
Homologene: 59263
Name: Eph receptor B4
Synonyms: Htk, b2b2412Clo, MDK2, Myk1, Tyro11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 13846
Homologene: 20939
Name: TraB domain containing 2B
Synonyms: Gm12824, Hkat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 666048
Homologene: 85034
Name: mucin 1, transmembrane
Synonyms: CD227, Muc-1, EMA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 17829
Homologene: 137248
Name: RAB27B, member RAS oncogene family
Synonyms: B130064M09Rik, 2310021G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 80718
Homologene: 20879
Name: translocase of outer mitochondrial membrane 34
Synonyms: TOM34, 2610100K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 67145
Homologene: 4956
Name: solute carrier family 26 (sulfate transporter), member 1
Synonyms: Sat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231583
Homologene: 32539
Name: polypeptide N-acetylgalactosaminyltransferase 17
Synonyms: Wbscr17, Gcap8, E330012B09Rik, Galnt19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 212996
Homologene: 49707
Name: expressed sequence AI987944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233168
Name: olfactory receptor 629
Synonyms: MOR26-2, GA_x6K02T2PBJ9-6466772-6465828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258818
Homologene: 105159
Name: olfactory receptor 1513
Synonyms: GA_x6K02T2RJGY-644134-645075, MOR223-10, MOR223-7P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 258008
Homologene: 79404
Name: RIKEN cDNA A930003A15 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 68162
VEGA: 16
Name: leucine rich repeat containing 58
Synonyms: 1810012N18Rik, C330018J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 320184
Homologene: 14598
Name: solute carrier family 22, member 28
Synonyms: Gm5631
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 434674
VEGA: 19
Homologene: 77136
Name: solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
Synonyms: 2610100G11Rik, Slc20a3, 1300019P08Rik, Dgsj
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 13358
Homologene: 4362
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 22,427,459 bp
  • A to G, chromosome 1 at 28,777,821 bp
  • A to T, chromosome 1 at 85,699,744 bp
  • T to A, chromosome 1 at 127,802,394 bp
  • A to G, chromosome 1 at 167,373,805 bp
  • T to A, chromosome 1 at 184,921,608 bp
  • C to T, chromosome 1 at 188,814,406 bp
  • GCCACCA to GCCA, chromosome 2 at 52,110,324 bp
  • T to C, chromosome 2 at 91,036,808 bp
  • T to C, chromosome 2 at 125,314,814 bp
  • T to C, chromosome 2 at 130,151,761 bp
  • T to C, chromosome 2 at 164,070,976 bp
  • TGAGGAGGAGGAGGAGGAGG to TGAGGAGGAGGAGGAGG, chromosome 2 at 181,797,505 bp
  • A to T, chromosome 3 at 3,651,629 bp
  • T to A, chromosome 3 at 54,714,701 bp
  • T to A, chromosome 3 at 58,636,122 bp
  • C to A, chromosome 3 at 89,230,328 bp
  • T to C, chromosome 3 at 154,265,474 bp
  • A to G, chromosome 4 at 114,580,322 bp
  • A to G, chromosome 4 at 128,884,215 bp
  • A to T, chromosome 4 at 143,698,486 bp
  • A to T, chromosome 5 at 73,089,081 bp
  • T to C, chromosome 5 at 90,946,942 bp
  • T to A, chromosome 5 at 108,673,523 bp
  • T to A, chromosome 5 at 111,231,081 bp
  • C to T, chromosome 5 at 113,279,184 bp
  • T to C, chromosome 5 at 123,630,721 bp
  • T to A, chromosome 5 at 129,902,272 bp
  • T to A, chromosome 5 at 131,150,916 bp
  • C to T, chromosome 5 at 135,132,475 bp
  • T to A, chromosome 5 at 137,365,667 bp
  • T to A, chromosome 5 at 144,266,641 bp
  • T to C, chromosome 6 at 3,372,725 bp
  • T to G, chromosome 6 at 121,302,867 bp
  • A to G, chromosome 6 at 128,516,195 bp
  • T to G, chromosome 6 at 140,642,364 bp
  • T to C, chromosome 7 at 41,376,859 bp
  • T to C, chromosome 7 at 56,206,036 bp
  • T to C, chromosome 7 at 103,740,925 bp
  • T to C, chromosome 7 at 108,564,998 bp
  • T to C, chromosome 7 at 119,777,100 bp
  • G to T, chromosome 8 at 3,853,205 bp
  • T to A, chromosome 8 at 13,172,654 bp
  • A to T, chromosome 8 at 15,132,924 bp
  • A to T, chromosome 8 at 27,344,720 bp
  • A to G, chromosome 8 at 33,295,006 bp
  • A to T, chromosome 8 at 45,087,937 bp
  • A to G, chromosome 8 at 70,393,013 bp
  • A to C, chromosome 8 at 71,683,978 bp
  • G to A, chromosome 9 at 20,499,799 bp
  • A to T, chromosome 9 at 38,472,785 bp
  • A to T, chromosome 9 at 108,404,801 bp
  • T to C, chromosome 10 at 7,907,581 bp
  • C to A, chromosome 10 at 19,002,949 bp
  • T to C, chromosome 10 at 22,702,016 bp
  • T to C, chromosome 10 at 50,845,666 bp
  • T to C, chromosome 10 at 81,588,947 bp
  • T to C, chromosome 10 at 87,165,069 bp
  • T to A, chromosome 11 at 28,583,296 bp
  • T to A, chromosome 11 at 75,165,801 bp
  • C to T, chromosome 11 at 84,024,305 bp
  • C to A, chromosome 11 at 107,110,812 bp
  • A to T, chromosome 11 at 110,040,564 bp
  • A to C, chromosome 12 at 61,839,668 bp
  • G to A, chromosome 13 at 24,863,580 bp
  • C to A, chromosome 13 at 55,003,933 bp
  • A to G, chromosome 13 at 74,316,324 bp
  • A to T, chromosome 13 at 100,035,825 bp
  • C to G, chromosome 13 at 102,737,387 bp
  • A to T, chromosome 14 at 30,941,555 bp
  • T to C, chromosome 14 at 52,349,378 bp
  • A to G, chromosome 15 at 6,764,278 bp
  • T to C, chromosome 15 at 31,480,291 bp
  • C to T, chromosome 15 at 76,693,669 bp
  • G to A, chromosome 15 at 97,761,585 bp
  • T to C, chromosome 15 at 99,243,449 bp
  • T to C, chromosome 16 at 4,419,271 bp
  • T to A, chromosome 16 at 17,927,436 bp
  • T to C, chromosome 16 at 19,883,872 bp
  • T to A, chromosome 16 at 32,475,849 bp
  • A to G, chromosome 16 at 33,900,583 bp
  • A to G, chromosome 16 at 37,878,573 bp
  • A to G, chromosome 16 at 48,959,675 bp
  • T to A, chromosome 17 at 26,203,318 bp
  • A to G, chromosome 18 at 22,516,040 bp
  • G to T, chromosome 18 at 32,939,454 bp
  • T to C, chromosome 18 at 49,833,148 bp
  • T to C, chromosome 18 at 60,845,832 bp
  • T to C, chromosome 18 at 69,987,041 bp
  • A to C, chromosome 18 at 89,207,020 bp
  • A to G, chromosome 19 at 7,285,824 bp
  • T to C, chromosome 19 at 8,116,833 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0744 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
038925-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.