Strain Name:
C57BL/6J-MtgxR0759Btlr/Mmmh
Stock Number:
038939-MU
Citation ID:
RRID:MMRRC_038939-MU
Other Names:
R0759 (G1), C57BL/6J-MtgxR0759Btlr
Major Collection:

Gene Information

Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: Fadk, FAK, FRNK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Cltc
Name: clathrin, heavy polypeptide (Hc)
Synonyms: CHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Rrm1
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20133
Homologene: 806
Dennd4c
Name: DENN/MADD domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329877
Homologene: 23057
Fubp1
Name: far upstream element (FUSE) binding protein 1
Synonyms: FBP, Fubp, Fubp4, 9530027K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 51886
HGNC: HGNC:4004
Homologene: 48253
Sbf1
Name: SET binding factor 1
Synonyms: 2610510A08Rik, Mtmr5, B230113C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 77980
Homologene: 84710
Colec11
Name: collectin sub-family member 11
Synonyms: 1010001H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 71693
VEGA: 12
Homologene: 11423
Cxcl16
Name: chemokine (C-X-C motif) ligand 16
Synonyms: SR-PSOX, 0910001K24Rik, SR-PSOX/CXCL16, Scavenger Receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66102
Homologene: 49694
Elavl1
Name: ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
Synonyms: Hua, 2410055N02Rik, W91709, HuR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 15568
HGNC: HGNC:3312
Homologene: 20367
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215690
Homologene: 10719
Slc9a1
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 1
Synonyms: antiporter, Apnh, Nhe1, Nhe-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20544
Homologene: 20660
Smpd3
Name: sphingomyelin phosphodiesterase 3, neutral
Synonyms: nSMase2, neutral sphingomyelinase II, 4631433G07Rik, fro
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 58994
Homologene: 10260
Stag3
Name: stromal antigen 3
Synonyms: stromalin 3, SA-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 50878
Homologene: 40844
Bsph2
Name: binder of sperm protein homolog 2
Synonyms: Bsph2a, 9230107M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77684
Homologene: 129597
Slurp1
Name: secreted Ly6/Plaur domain containing 1
Synonyms: ARS component B, 1110021N19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 57277
Homologene: 10710
Sec14l2
Name: SEC14-like lipid binding 2
Synonyms: 1300013M05Rik, tap, Spf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67815
Homologene: 8245
Wdr87-ps
Name: WD repeat domain 87, pseudogene
Synonyms: 4932431P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 114675
Il1a
Name: interleukin 1 alpha
Synonyms: Il-1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16175
HGNC: HGNC:5991
Homologene: 480
Trp53i11
Name: transformation related protein 53 inducible protein 11
Synonyms: Tp53i11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 277414
Homologene: 4404
Xpc
Name: xeroderma pigmentosum, complementation group C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22591
Homologene: 3401
Tril
Name: TLR4 interactor with leucine-rich repeats
Synonyms: 1200009O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66873
Homologene: 69404
Olfr743
Name: olfactory receptor 743
Synonyms: GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, MOR106-14, Olfr265, Olfr743-ps1, Olfr264
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219019
Homologene: 74163
C1s1
Name: complement component 1, s subcomponent 1
Synonyms: C1s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 50908
HGNC: HGNC:1247
Homologene: 1314
Ces1c
Name: carboxylesterase 1C
Synonyms: Es-N, Es-4, Es-1, Ee-1, Es1, Ces-N
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13884
HGNC: HGNC:1863
Homologene: 117484
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22625
Homologene: 19318
Nr0b2
Name: nuclear receptor subfamily 0, group B, member 2
Synonyms: small heterodimer partner, SHP-1, SHP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 23957
HGNC: HGNC:7961
Homologene: 8030
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: 6720455I24Rik, Snep, D430044C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208777
Homologene: 14708
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 107868
Homologene: 68408
Ptdss1
Name: phosphatidylserine synthase 1
Synonyms: PtdSer Synthase-1, PSS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19210
VEGA: 13
HGNC: HGNC:9587
Homologene: 7494
A430078G23Rik
Name: RIKEN cDNA A430078G23 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Pdilt
Name: protein disulfide isomerase-like, testis expressed
Synonyms: PDILT, 1700007B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71830
Homologene: 18382
Trim35
Name: tripartite motif-containing 35
Synonyms: Mair, 0710005M05Rik, A430106H13Rik, Hls5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66854
Homologene: 134331
Hoxc8
Name: homeobox C8
Synonyms: Hox-3.1, D130011F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 15426
HGNC: HGNC:5129
Homologene: 130642
Ppl
Name: periplakin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 93,272,564 bp
  • A to G, chromosome 1 at 127,817,425 bp
  • A to G, chromosome 1 at 135,455,260 bp
  • A to G, chromosome 2 at 93,198,958 bp
  • T to A, chromosome 2 at 129,304,687 bp
  • TGGCGGCGGCGGCGGCGG to TGGCGGCGGCGGCGGCGGCGG, chromosome 3 at 152,210,637 bp
  • A to G, chromosome 4 at 86,788,829 bp
  • T to A, chromosome 4 at 133,416,403 bp
  • A to T, chromosome 4 at 133,553,738 bp
  • A to G, chromosome 5 at 138,308,670 bp
  • G to T, chromosome 6 at 53,818,027 bp
  • A to T, chromosome 6 at 91,498,142 bp
  • T to C, chromosome 6 at 124,531,437 bp
  • A to T, chromosome 7 at 13,556,727 bp
  • T to C, chromosome 7 at 29,531,519 bp
  • A to G, chromosome 7 at 102,457,561 bp
  • A to T, chromosome 7 at 119,489,484 bp
  • T to G, chromosome 8 at 3,388,822 bp
  • C to A, chromosome 8 at 4,289,815 bp
  • G to A, chromosome 8 at 93,130,864 bp
  • T to C, chromosome 8 at 106,265,228 bp
  • T to C, chromosome 11 at 4,111,429 bp
  • C to T, chromosome 11 at 70,459,128 bp
  • A to C, chromosome 11 at 86,737,082 bp
  • A to G, chromosome 12 at 28,594,731 bp
  • T to C, chromosome 13 at 66,987,804 bp
  • A to T, chromosome 14 at 32,662,497 bp
  • T to C, chromosome 14 at 50,533,702 bp
  • T to A, chromosome 14 at 66,308,787 bp
  • A to G, chromosome 15 at 73,296,584 bp
  • A to G, chromosome 15 at 74,726,959 bp
  • A to T, chromosome 15 at 89,304,716 bp
  • T to C, chromosome 15 at 102,992,553 bp
  • A to G, chromosome 16 at 5,089,777 bp
  • A to G, chromosome 17 at 12,410,951 bp
  • T to C, chromosome Y at 1,299,097 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0759 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.