Strain Name:
C57BL/6J-MtgxR0811Btlr/Mmmh
Stock Number:
038991-MU
Citation ID:
RRID:MMRRC_038991-MU
Other Names:
R0811 (G1), C57BL/6J-MtgxR0811Btlr
Major Collection:

Strain Information

Gba
Name: glucosidase, beta, acid
Synonyms: betaGC, GBA1, GC, GCase, glucocerebrosidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14466
HGNC: HGNC:4177
Homologene: 68040
Tk1
Name: thymidine kinase 1
Synonyms: Tk-1, D530002A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21877
Homologene: 37749
Ippk
Name: inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Synonyms: 1810043M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75678
VEGA: 13
Homologene: 41495
Cnmd
Name: chondromodulin
Synonyms: ChM-I, Chondromodulin 1, Lect1, Bricd3, Chmd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16840
Homologene: 5095
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: Cav3.2, T-type Cav3.2, alpha13.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Mga
Name: MAX gene associated
Synonyms: D030062C11Rik, Mga, Mad5, C130042M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 29808
Homologene: 49351
Trim13
Name: tripartite motif-containing 13
Synonyms: 3110001L12Rik, Rfp2, RNF77, LEU5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66597
VEGA: 14
HGNC: HGNC:9976
Homologene: 4234
Psmb2
Name: proteasome (prosome, macropain) subunit, beta type 2
Synonyms: HC7-I, D4Wsu33e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26445
HGNC: HGNC:9539
Homologene: 2088
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Enox1
Name: ecto-NOX disulfide-thiol exchanger 1
Synonyms: D230005D02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239188
VEGA: 14
Homologene: 56793
Mllt6
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms: Af17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 246198
HGNC: HGNC:7138
Homologene: 31347
Srfbp1
Name: serum response factor binding protein 1
Synonyms: 2810036K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67222
VEGA: 18
Homologene: 12101
Leo1
Name: Leo1, Paf1/RNA polymerase II complex component
Synonyms: LOC235497
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235497
VEGA: 9
Homologene: 133895
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Cnn3
Name: calponin 3, acidic
Synonyms: 1600014M03Rik, Calpo3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71994
HGNC: HGNC:2157
Homologene: 37533
Eef2
Name: eukaryotic translation elongation factor 2
Synonyms: Ef-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13629
VEGA: 10
HGNC: HGNC:3214
Homologene: 134867
Tbl1xr1
Name: transducin (beta)-like 1X-linked receptor 1
Synonyms: A630076E03Rik, TBLR1, 8030499H02Rik, DC42, C230089I12Rik, Ira1, C21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 81004
Homologene: 69382
Slc8a2
Name: solute carrier family 8 (sodium/calcium exchanger), member 2
Synonyms: Ncx2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110891
Homologene: 27358
Nubp1
Name: nucleotide binding protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 26425
HGNC: HGNC:8041
Homologene: 1857
Zfp219
Name: zinc finger protein 219
Synonyms: 2010302A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 69890
VEGA: 14
Homologene: 9504
Lca5
Name: Leber congenital amaurosis 5 (human)
Synonyms: 4930431B11Rik, ORF64, 5730406O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75782
Homologene: 32718
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: Zfp161, b2b1982Clo, ZF5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22666
Homologene: 2560
Ap5z1
Name: adaptor-related protein complex 5, zeta 1 subunit
Synonyms: C330006K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231855
Homologene: 18213
Gdpd5
Name: glycerophosphodiester phosphodiesterase domain containing 5
Synonyms: Gde2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233552
Homologene: 32741
Raf1
Name: v-raf-leukemia viral oncogene 1
Synonyms: 6430402F14Rik, Craf1, Raf-1, sarcoma 3611 oncogene, c-Raf, v-Raf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 110157
HGNC: HGNC:9829
Homologene: 48145
Pithd1
Name: PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Synonyms: 1110049F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66193
Homologene: 10678
Arhgap28
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268970
Homologene: 18264
Rbm48
Name: RNA binding motif protein 48
Synonyms: C030048B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269623
Homologene: 12944
Mphosph9
Name: M-phase phosphoprotein 9
Synonyms: MPP-9, B930097C17Rik, 4930548D04Rik, 9630025B04Rik, MPP9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269702
HGNC: HGNC:7215
Homologene: 11256
Ptgs2
Name: prostaglandin-endoperoxide synthase 2
Synonyms: PHS-2, Tis10, PGHS-2, Pghs2, cyclooxygenase 2, COX2, Cox-2, cyclooxygenase-2, prostaglandin G/H synthase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19225
HGNC: HGNC:9605
Homologene: 31000
Itga2
Name: integrin alpha 2
Synonyms: CD49B, VLA-2 receptor, alpha 2 subunit, DX5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16398
VEGA: 13
HGNC: HGNC:6137
Homologene: 1662
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Ksr2
Name: kinase suppressor of ras 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 333050
Homologene: 45469
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Fat2
Name: FAT atypical cadherin 2
Synonyms: EMI2, mKIAA0811, Fath2, LOC245827
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Srrm3
Name: serine/arginine repetitive matrix 3
Synonyms: 2900083I11Rik, Srrm2l, SRm300-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 58212
Homologene: 136723
Ugcg
Name: UDP-glucose ceramide glucosyltransferase
Synonyms: Epcs21, GlcT-1, Ugcgl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22234
Homologene: 37763
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Gucy1b1
Name: guanylate cyclase 1, soluble, beta 1
Synonyms: beta 1 sGC, Gucy1b3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 54195
HGNC: HGNC:4687
Homologene: 664
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329628
Homologene: 14377
Ndrg2
Name: N-myc downstream regulated gene 2
Synonyms: Ndr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 29811
VEGA: 14
Homologene: 22785
Kcnab1
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 1
Synonyms: Kvbeta1.1, mKv(beta)1, Akr8a8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 16497
HGNC: HGNC:6228
Homologene: 56491
Ptpro
Name: protein tyrosine phosphatase receptor type O
Synonyms: PTP-U2, PTPROt, PTP-phi, GLEPP1, PTP-BK, D28, PTP-oc, Ptpn15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Slc22a1
Name: solute carrier family 22 (organic cation transporter), member 1
Synonyms: Orct, Orct1, Oct1, Lx1, Oct1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20517
VEGA: 17
Homologene: 20665
Kcna10
Name: potassium voltage-gated channel, shaker-related subfamily, member 10
Synonyms: Kcna8, Kv1.8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242151
HGNC: HGNC:6219
Homologene: 4054
Krt6a
Name: keratin 6A
Synonyms: MK6a, Krt2-6c, mK6[a], Krt2-6a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16687
VEGA: 15
Homologene: 136794
Arrb1
Name: arrestin, beta 1
Synonyms: 1200006I17Rik, beta-arrestin1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 109689
HGNC: HGNC:711
Homologene: 2981
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228602
Homologene: 12623
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231470
Homologene: 23516
Vmn2r75
Name: vomeronasal 2, receptor 75
Synonyms: EG546981
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546981
Homologene: 115466
Dennd5a
Name: DENN domain containing 5A
Synonyms: 1500012B19Rik, Rab6ip1, ORF37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19347
Homologene: 14584
Slfn10-ps
Name: schlafen 10, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237887
Pnpla8
Name: patatin-like phospholipase domain containing 8
Synonyms: iPLA2 gamma, 1200006O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 67452
Homologene: 12136
Zfp329
Name: zinc finger protein 329
Synonyms: 4632409L22Rik, 2810439M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67230
Homologene: 23459
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: BK channel alpha subunit, mSlo1, BKCa, Slo, Slo1, 5730414M22Rik, MaxiK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Spata16
Name: spermatogenesis associated 16
Synonyms: 4921511F01Rik, 4930503K02Rik, Nyd-sp12, spermatogenesis-related protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70862
Homologene: 49974
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 632671
Atrnl1
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: TPRBK, 2310015L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 209683
Homologene: 41023
Mvp
Name: major vault protein
Synonyms: LRP, VAULT1, 2310009M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78388
HGNC: HGNC:7531
Homologene: 3752
Fam171a1
Name: family with sequence similarity 171, member A1
Synonyms: 9630050M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269233
Homologene: 19521
Rhof
Name: ras homolog family member F (in filopodia)
Synonyms: Arhf, Ifld1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 23912
Homologene: 41304
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242248
Homologene: 9926
Abcc3
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Synonyms: MRP3, 1700019L09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Mael
Name: maelstrom spermatogenic transposon silencer
Synonyms: 4933405K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98558
Homologene: 13143
Lcp1
Name: lymphocyte cytosolic protein 1
Synonyms: Pls2, L-fimbrin, D14Ertd310e, L-plastin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 18826
HGNC: HGNC:6528
Homologene: 80174
Spam1
Name: sperm adhesion molecule 1
Synonyms: Ph-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20690
Homologene: 7547
Cenpo
Name: centromere protein O
Synonyms: 8430427C03Rik, 2810429O05Rik, D12Ertd482e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 52504
Homologene: 49760
Cc2d1a
Name: coiled-coil and C2 domain containing 1A
Synonyms: Freud-1, Tape
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212139
Homologene: 23040
Slc24a5
Name: solute carrier family 24, member 5
Synonyms: F630045L20Rik, NCX5, Oca6, NCKX5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 317750
Homologene: 18400
Rhag
Name: Rhesus blood group-associated A glycoprotein
Synonyms: CD241, Rh50, Rh50A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19743
Homologene: 68045
Vmn2r86
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 625109
Homologene: 129606
Abcb1a
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 1A
Synonyms: Pgy-3, multiple drug resistant 1a, mdr-3, P-gp, Evi32, Pgy3, MDR3, Mdr1a, Pgp, P-glycoprotein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18671
HGNC: HGNC:40
Homologene: 55496
Kcnip4
Name: Kv channel interacting protein 4
Synonyms: KChIP4a, Calp250
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80334
Homologene: 23528
H2-Ob
Name: histocompatibility 2, O region beta locus
Synonyms: vic1, H-2I, H2-IAb2, Ob, H2-Ab, A-beta-2, H2-Ab2, H-2Ob, A-beta2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15002
HGNC: HGNC:4937
Homologene: 1602
Or1e1f
Name: olfactory receptor family 1 subfamily E member 1F
Synonyms: Olfr397, GA_x6K02T2P1NL-4121434-4122381, MOR135-28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258343
Homologene: 138309
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Cox10
Name: heme A:farnesyltransferase cytochrome c oxidase assembly factor 10
Synonyms: 2410004F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70383
HGNC: HGNC:2260
Homologene: 80170
Ugt1a10
Name: UDP glycosyltransferase 1 family, polypeptide A10
Synonyms: A13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 394430
Homologene: 133281
Klhl22
Name: kelch-like 22
Synonyms: 2610318I18Rik, Kelchl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224023
Homologene: 23784
Or8d2
Name: olfactory receptor family 8 subfamily D member 2
Synonyms: Olfr1520-ps1, Olfr924, MOR171-27P, MOR171-47, MOR171-27P, GA_x6K02T2PVTD-32543982-32544908
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 404322
VEGA: 9
HGNC: HGNC:8482
Homologene: 128215
Or1o2
Name: olfactory receptor family 1 subfamily O member 2
Synonyms: Olfr97, GA_x6K02T2PSCP-1672287-1671355, MOR156-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258505
Homologene: 133051
Cyp2d34
Name: cytochrome P450, family 2, subfamily d, polypeptide 34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223706
VEGA: 15
HGNC: HGNC:2625
Homologene: 86099
Lipt1
Name: lipoyltransferase 1
Synonyms: EG623661
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 623661
Homologene: 50569
Ctdsp1
Name: CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
Synonyms: SCP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227292
Homologene: 100834
E130304I02Rik
Name: RIKEN cDNA E130304I02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78547
Grtp1
Name: GH regulated TBC protein 1
Synonyms: 5430401C05Rik, Tbc1d6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66790
Homologene: 84592
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 37,875,301 bp
  • T to C, chromosome 1 at 74,394,647 bp
  • T to A, chromosome 1 at 88,056,182 bp
  • C to T, chromosome 1 at 150,101,354 bp
  • A to T, chromosome 1 at 166,235,399 bp
  • A to G, chromosome 2 at 3,197,427 bp
  • G to A, chromosome 2 at 31,420,371 bp
  • T to C, chromosome 2 at 52,292,695 bp
  • C to T, chromosome 2 at 119,947,961 bp
  • T to C, chromosome 2 at 125,068,804 bp
  • C to T, chromosome 2 at 125,403,170 bp
  • A to G, chromosome 2 at 130,713,414 bp
  • T to A, chromosome 3 at 22,200,587 bp
  • T to A, chromosome 3 at 26,913,338 bp
  • A to T, chromosome 3 at 38,957,474 bp
  • G to A, chromosome 3 at 65,297,720 bp
  • T to C, chromosome 3 at 82,037,988 bp
  • T to C, chromosome 3 at 89,204,000 bp
  • A to T, chromosome 3 at 107,195,259 bp
  • G to A, chromosome 3 at 121,454,951 bp
  • T to A, chromosome 3 at 136,093,366 bp
  • C to T, chromosome 4 at 59,207,798 bp
  • T to A, chromosome 4 at 126,707,557 bp
  • A to G, chromosome 4 at 135,977,134 bp
  • A to T, chromosome 5 at 3,591,760 bp
  • T to C, chromosome 5 at 8,713,229 bp
  • T to A, chromosome 5 at 48,409,860 bp
  • T to A, chromosome 5 at 96,752,998 bp
  • A to T, chromosome 5 at 111,235,500 bp
  • A to C, chromosome 5 at 117,555,225 bp
  • A to C, chromosome 5 at 123,131,887 bp
  • A to C, chromosome 5 at 124,298,759 bp
  • A to C, chromosome 5 at 135,873,282 bp
  • G to A, chromosome 5 at 142,475,791 bp
  • C to A, chromosome 5 at 151,572,930 bp
  • G to A, chromosome 6 at 24,796,887 bp
  • A to G, chromosome 6 at 115,626,710 bp
  • A to G, chromosome 6 at 137,368,079 bp
  • T to A, chromosome 7 at 12,811,468 bp
  • T to C, chromosome 7 at 16,141,114 bp
  • G to A, chromosome 7 at 35,802,623 bp
  • C to T, chromosome 7 at 86,165,367 bp
  • A to G, chromosome 7 at 99,438,333 bp
  • G to T, chromosome 7 at 99,598,501 bp
  • G to A, chromosome 7 at 109,933,613 bp
  • G to A, chromosome 7 at 126,987,556 bp
  • T to C, chromosome 8 at 13,179,639 bp
  • A to G, chromosome 8 at 84,133,836 bp
  • G to A, chromosome 9 at 38,848,509 bp
  • C to A, chromosome 9 at 67,934,476 bp
  • G to A, chromosome 9 at 75,445,549 bp
  • T to C, chromosome 9 at 83,399,753 bp
  • T to C, chromosome 10 at 58,465,529 bp
  • C to CN, chromosome 10 at 81,178,769 bp
  • C to T, chromosome 10 at 130,453,628 bp
  • T to A, chromosome 11 at 55,253,633 bp
  • A to G, chromosome 11 at 64,071,713 bp
  • G to A, chromosome 11 at 73,965,420 bp
  • G to A, chromosome 11 at 83,035,562 bp
  • G to A, chromosome 11 at 94,375,202 bp
  • A to G, chromosome 11 at 97,678,561 bp
  • T to C, chromosome 11 at 117,822,107 bp
  • A to G, chromosome 12 at 4,216,643 bp
  • G to A, chromosome 12 at 44,283,405 bp
  • C to A, chromosome 13 at 49,443,471 bp
  • A to T, chromosome 13 at 114,870,614 bp
  • G to A, chromosome 14 at 23,300,018 bp
  • G to A, chromosome 14 at 34,822,619 bp
  • A to G, chromosome 14 at 51,908,662 bp
  • T to A, chromosome 14 at 52,006,938 bp
  • G to A, chromosome 14 at 61,605,700 bp
  • A to G, chromosome 14 at 75,214,488 bp
  • T to A, chromosome 14 at 77,582,436 bp
  • A to G, chromosome 14 at 79,661,423 bp
  • A to T, chromosome 15 at 82,618,606 bp
  • C to T, chromosome 15 at 101,692,748 bp
  • C to A, chromosome 16 at 10,413,721 bp
  • T to A, chromosome 16 at 17,792,589 bp
  • T to C, chromosome 17 at 12,666,618 bp
  • A to G, chromosome 17 at 25,388,628 bp
  • A to G, chromosome 17 at 34,244,126 bp
  • A to C, chromosome 17 at 37,232,332 bp
  • A to T, chromosome 17 at 40,831,578 bp
  • TCAGCAGCAGCAGCAGCAGCAG to TCAGCAGCAGCAGCAGCAG, chromosome 17 at 67,901,299 bp
  • C to A, chromosome 17 at 69,388,502 bp
  • A to G, chromosome 18 at 52,487,516 bp
  • T to A, chromosome 19 at 57,673,141 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0811 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038991-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.