Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0811Btlr/Mmmh
Stock Number:
038991-MU
Citation ID:
RRID:MMRRC_038991-MU
Other Names:
R0811 (G1), C57BL/6J-MtgxR0811Btlr
Major Collection:

Strain Information

Gba1
Name: glucosylceramidase beta 1
Synonyms: glucocerebrosidase, GC, GCase, GBA1, betaGC, Gba
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14466
HGNC: HGNC:4177
Homologene: 68040
Tk1
Name: thymidine kinase 1
Synonyms: Tk-1, D530002A18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21877
Homologene: 37749
Ippk
Name: inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Synonyms: 1810043M15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75678
VEGA: 13
Homologene: 41495
Cnmd
Name: chondromodulin
Synonyms: Chondromodulin 1, ChM-I, Bricd3, Chmd, Lect1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16840
Homologene: 5095
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Trim13
Name: tripartite motif-containing 13
Synonyms: 3110001L12Rik, LEU5, Rfp2, RNF77
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66597
VEGA: 14
HGNC: HGNC:9976
Homologene: 4234
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 37,875,301 bp
  • T to C, chromosome 1 at 74,394,647 bp
  • T to A, chromosome 1 at 88,056,182 bp
  • C to T, chromosome 1 at 150,101,354 bp
  • A to T, chromosome 1 at 166,235,399 bp
  • A to G, chromosome 2 at 3,197,427 bp
  • G to A, chromosome 2 at 31,420,371 bp
  • T to C, chromosome 2 at 52,292,695 bp
  • C to T, chromosome 2 at 119,947,961 bp
  • T to C, chromosome 2 at 125,068,804 bp
  • C to T, chromosome 2 at 125,403,170 bp
  • A to G, chromosome 2 at 130,713,414 bp
  • T to A, chromosome 3 at 22,200,587 bp
  • T to A, chromosome 3 at 26,913,338 bp
  • A to T, chromosome 3 at 38,957,474 bp
  • G to A, chromosome 3 at 65,297,720 bp
  • T to C, chromosome 3 at 82,037,988 bp
  • T to C, chromosome 3 at 89,204,000 bp
  • A to T, chromosome 3 at 107,195,259 bp
  • G to A, chromosome 3 at 121,454,951 bp
  • T to A, chromosome 3 at 136,093,366 bp
  • C to T, chromosome 4 at 59,207,798 bp
  • T to A, chromosome 4 at 126,707,557 bp
  • A to G, chromosome 4 at 135,977,134 bp
  • A to T, chromosome 5 at 3,591,760 bp
  • T to C, chromosome 5 at 8,713,229 bp
  • T to A, chromosome 5 at 48,409,860 bp
  • T to A, chromosome 5 at 96,752,998 bp
  • A to T, chromosome 5 at 111,235,500 bp
  • A to C, chromosome 5 at 117,555,225 bp
  • A to C, chromosome 5 at 123,131,887 bp
  • A to C, chromosome 5 at 124,298,759 bp
  • A to C, chromosome 5 at 135,873,282 bp
  • G to A, chromosome 5 at 142,475,791 bp
  • C to A, chromosome 5 at 151,572,930 bp
  • G to A, chromosome 6 at 24,796,887 bp
  • A to G, chromosome 6 at 115,626,710 bp
  • A to G, chromosome 6 at 137,368,079 bp
  • T to A, chromosome 7 at 12,811,468 bp
  • T to C, chromosome 7 at 16,141,114 bp
  • G to A, chromosome 7 at 35,802,623 bp
  • C to T, chromosome 7 at 86,165,367 bp
  • A to G, chromosome 7 at 99,438,333 bp
  • G to T, chromosome 7 at 99,598,501 bp
  • G to A, chromosome 7 at 109,933,613 bp
  • G to A, chromosome 7 at 126,987,556 bp
  • T to C, chromosome 8 at 13,179,639 bp
  • A to G, chromosome 8 at 84,133,836 bp
  • G to A, chromosome 9 at 38,848,509 bp
  • C to A, chromosome 9 at 67,934,476 bp
  • G to A, chromosome 9 at 75,445,549 bp
  • T to C, chromosome 9 at 83,399,753 bp
  • T to C, chromosome 10 at 58,465,529 bp
  • C to CN, chromosome 10 at 81,178,769 bp
  • C to T, chromosome 10 at 130,453,628 bp
  • T to A, chromosome 11 at 55,253,633 bp
  • A to G, chromosome 11 at 64,071,713 bp
  • G to A, chromosome 11 at 73,965,420 bp
  • G to A, chromosome 11 at 83,035,562 bp
  • G to A, chromosome 11 at 94,375,202 bp
  • A to G, chromosome 11 at 97,678,561 bp
  • T to C, chromosome 11 at 117,822,107 bp
  • A to G, chromosome 12 at 4,216,643 bp
  • G to A, chromosome 12 at 44,283,405 bp
  • C to A, chromosome 13 at 49,443,471 bp
  • A to T, chromosome 13 at 114,870,614 bp
  • G to A, chromosome 14 at 23,300,018 bp
  • G to A, chromosome 14 at 34,822,619 bp
  • A to G, chromosome 14 at 51,908,662 bp
  • T to A, chromosome 14 at 52,006,938 bp
  • G to A, chromosome 14 at 61,605,700 bp
  • A to G, chromosome 14 at 75,214,488 bp
  • T to A, chromosome 14 at 77,582,436 bp
  • A to G, chromosome 14 at 79,661,423 bp
  • A to T, chromosome 15 at 82,618,606 bp
  • C to T, chromosome 15 at 101,692,748 bp
  • C to A, chromosome 16 at 10,413,721 bp
  • T to A, chromosome 16 at 17,792,589 bp
  • T to C, chromosome 17 at 12,666,618 bp
  • A to G, chromosome 17 at 25,388,628 bp
  • A to G, chromosome 17 at 34,244,126 bp
  • A to C, chromosome 17 at 37,232,332 bp
  • A to T, chromosome 17 at 40,831,578 bp
  • TCAGCAGCAGCAGCAGCAGCAG to TCAGCAGCAGCAGCAGCAG, chromosome 17 at 67,901,299 bp
  • C to A, chromosome 17 at 69,388,502 bp
  • A to G, chromosome 18 at 52,487,516 bp
  • T to A, chromosome 19 at 57,673,141 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0811 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038991-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.