Strain Name:
C57BL/6J-MtgxR0941Btlr/Mmmh
Stock Number:
039080-MU
Citation ID:
RRID:MMRRC_039080-MU
Other Names:
R0941 (G1), C57BL/6J-MtgxR0941Btlr
Major Collection:

Gene Information

Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Atp1b1
Name: ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms: sodium/potassium ATPase beta subunit, Atpb, Atpb-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11931
HGNC: HGNC:804
Homologene: 37509
Serpini1
Name: serine (or cysteine) peptidase inhibitor, clade I, member 1
Synonyms: Neuroserpin, PI12, Spi17, Ns
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20713
HGNC: HGNC:8943
Homologene: 21045
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 51869
Homologene: 41231
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310067L22Rik, 2310010G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75723
Homologene: 43977
Gpc1
Name: glypican 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14733
HGNC: HGNC:4449
Homologene: 20477
Kdm3b
Name: KDM3B lysine (K)-specific demethylase 3B
Synonyms: 5830462I21Rik, JHDM2B, Jmjd1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 277250
VEGA: 18
HGNC: HGNC:1337
Homologene: 41145
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Wcrf180, Acf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Acaa2
Name: acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)
Synonyms: 0610011L04Rik, D18Ertd240e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 52538
VEGA: 18
HGNC: HGNC:83
Homologene: 4456
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: 9930021J17Rik, Fam160a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229488
Homologene: 85149
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20739
Homologene: 74460
Gm12695
Name: predicted gene 12695
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 620779
Homologene: 51847
Ahnak
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230622
Homologene: 135888
C4b
Name: complement component 4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12268
Homologene: 36030
Unc5d
Name: unc-5 netrin receptor D
Synonyms: Unc5h4, D930029E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 210801
Homologene: 15450
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Col4a-1, Del(8)Bru44H, Del(8)44H, Bru, Svc, Raw, alpha1(IV) collagen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Mybpc2
Name: myosin binding protein C, fast-type
Synonyms: Fast-type C-protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233199
HGNC: HGNC:7550
Homologene: 3331
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Vmn2r7
Name: vomeronasal 2, receptor 7
Synonyms: 4933425M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 319217
Homologene: 129754
Afmid
Name: arylformamidase
Synonyms: Kf, formylkynureninase, formylase, kynurenine formamidase, 9030621K19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71562
Homologene: 41731
Igsf8
Name: immunoglobulin superfamily, member 8
Synonyms: ESTM34, EWI-2, PG regulatory-like protein, PGRL, KCT-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 140559
Homologene: 14163
Gnmt
Name: glycine N-methyltransferase
Synonyms: glycine N methyl transferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14711
HGNC: HGNC:4415
Homologene: 7741
Shc3
Name: src homology 2 domain-containing transforming protein C3
Synonyms: ShcC, N-Shc, Rai
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20418
VEGA: 13
Homologene: 7536
Olfr654
Name: olfactory receptor 654
Synonyms: GA_x6K02T2PBJ9-7215221-7216195, MOR38-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258377
Homologene: 90859
Casd1
Name: CAS1 domain containing 1
Synonyms: Cast1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 213819
Homologene: 11287
Sult2a2
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 2
Synonyms: mSTa2, Sth2, C730007P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100043194
Gm15350
Name: predicted gene 15350
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100504249
Mterf2
Name: mitochondrial transcription termination factor 2
Synonyms: 1700007D05Rik, Mterfd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74238
VEGA: 10
Homologene: 11869
Ltc4s
Name: leukotriene C4 synthase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17001
HGNC: HGNC:6719
Homologene: 7406
Arf3
Name: ADP-ribosylation factor 3
Synonyms: 5430400P17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11842
HGNC: HGNC:654
Homologene: 68195
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 92,857,309 bp
  • A to G, chromosome 1 at 153,332,274 bp
  • A to C, chromosome 1 at 164,443,260 bp
  • C to T, chromosome 1 at 172,316,396 bp
  • T to C, chromosome 1 at 174,245,205 bp
  • GCCACCA to GCCA, chromosome 2 at 52,110,324 bp
  • A to G, chromosome 2 at 76,719,023 bp
  • A to T, chromosome 3 at 64,716,579 bp
  • A to T, chromosome 3 at 75,616,627 bp
  • G to T, chromosome 3 at 85,673,059 bp
  • A to T, chromosome 3 at 90,461,409 bp
  • C to A, chromosome 4 at 96,728,217 bp
  • T to A, chromosome 4 at 113,238,358 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • T to C, chromosome 6 at 4,635,848 bp
  • A to T, chromosome 6 at 17,491,394 bp
  • C to T, chromosome 7 at 13,734,890 bp
  • T to C, chromosome 7 at 44,506,887 bp
  • C to T, chromosome 7 at 104,588,338 bp
  • C to T, chromosome 8 at 11,208,296 bp
  • A to G, chromosome 8 at 12,831,174 bp
  • T to C, chromosome 8 at 28,759,027 bp
  • A to C, chromosome 9 at 14,596,558 bp
  • G to A, chromosome 10 at 85,120,070 bp
  • T to G, chromosome 11 at 50,237,442 bp
  • T to A, chromosome 11 at 117,835,245 bp
  • A to T, chromosome 12 at 54,898,431 bp
  • A to G, chromosome 12 at 70,248,263 bp
  • T to C, chromosome 13 at 51,480,206 bp
  • A to G, chromosome 15 at 98,741,103 bp
  • T to A, chromosome 17 at 34,740,055 bp
  • A to G, chromosome 17 at 46,726,345 bp
  • C to T, chromosome 17 at 67,775,865 bp
  • T to A, chromosome 18 at 34,803,552 bp
  • G to T, chromosome 18 at 74,798,343 bp
  • A to G, chromosome 19 at 9,009,914 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0941 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039080-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.