Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0943Btlr/Mmmh
Stock Number:
039082-MU
Citation ID:
RRID:MMRRC_039082-MU
Other Names:
R0943 (G1), C57BL/6J-MtgxR0943Btlr
Major Collection:

Strain Information

Prkar2a
Name: protein kinase, cAMP dependent regulatory, type II alpha
Synonyms: RII(alpha), 1110061A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19087
HGNC: HGNC:9391
Homologene: 3064
Spry2
Name: sprouty RTK signaling antagonist 2
Synonyms: sprouty2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 24064
VEGA: 14
Homologene: 4267
Emx1
Name: empty spiracles homeobox 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13796
HGNC: HGNC:3340
Homologene: 55799
Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75137
Homologene: 19997
Lcmt1
Name: leucine carboxyl methyltransferase 1
Synonyms: Lcmt, LCMT-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30949
Homologene: 41123
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: ESR, ERalpha, ER[a], Nr3a1, ERa, Estr, Estra, ER-alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Ptprc
Name: protein tyrosine phosphatase receptor type C
Synonyms: T200, B220, CD45, Lyt-4, Ly-5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Tmt1a
Name: thiol methyltransferase 1A1
Synonyms: 2210414H16Rik, 3300001H21Rik, Mettl7a, Mettl7a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70152
VEGA: 15
Homologene: 86842
Fam72a
Name: family with sequence similarity 72, member A
Synonyms: 2700049P18Rik, P17
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108900
Homologene: 82352
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: Bromi, C6orf170, D630037F22Rik, b2b2284Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Rnf26rt
Name: ring finger protein 26, retrotransposed
Synonyms: Gm9008
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 668155
Agtpbp1
Name: ATP/GTP binding protein 1
Synonyms: Nna1, 2900054O13Rik, 4930445M19Rik, 1700020N17Rik, 5730402G09Rik, 2310001G17Rik, Ccp1, atms
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67269
Homologene: 9067
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Dym
Name: dymeclin
Synonyms: 1810041M12Rik, C030019K18Rik, 4933427L07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69190
VEGA: 18
Homologene: 69237
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: NY-CO-33, D18Bwg1409e, 5730407I04Rik, Mtsh1, Sdccag33, teashirt1, Tsh1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110796
Homologene: 4227
Xab2
Name: XPA binding protein 2
Synonyms: 0610041O14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67439
Homologene: 5738
Fads2b
Name: fatty acid desaturase 2B
Synonyms: 4833423E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228151
Homologene: 105643
Vmn2r108
Name: vomeronasal 2, receptor 108
Synonyms: EG627805
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627805
Homologene: 129678
Fanca
Name: Fanconi anemia, complementation group A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14087
HGNC: HGNC:3582
Homologene: 108
Zfp735
Name: zinc finger protein 735
Synonyms: 1700012C15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76390
Homologene: 88945
AC149051.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
AC162391.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Tbrg4
Name: transforming growth factor beta regulated gene 4
Synonyms: TB-12, Cpr2, 2310042P22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21379
Homologene: 31259
Neil3
Name: nei like 3 (E. coli)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234258
Homologene: 10094
Or4c10b
Name: olfactory receptor family 4 subfamily C member 10B
Synonyms: GA_x6K02T2Q125-51319458-51320387, MOR232-1, Olfr1257
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258984
Homologene: 115501
Nars2
Name: asparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244141
Homologene: 57002
Zswim2
Name: zinc finger SWIM-type containing 2
Synonyms: 1700025P14Rik, 4933437F18Rik, MEX
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71861
Homologene: 32689
Shfl
Name: shiftless antiviral inhibitor of ribosomal frameshifting
Synonyms: A230050P20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319278
Homologene: 10165
Vps45
Name: vacuolar protein sorting 45
Synonyms: mVps45
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22365
Homologene: 5250
Or5b112
Name: olfactory receptor family 5 subfamily B member 112
Synonyms: GA_x6K02T2RE5P-3672907-3673839, MOR202-12, Olfr1466
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258689
HGNC: HGNC:8324
Homologene: 133677
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 131,528,779 bp
  • T to C, chromosome 1 at 138,111,164 bp
  • GCCACCA to GCCA, chromosome 2 at 52,110,324 bp
  • T to A, chromosome 2 at 83,917,998 bp
  • C to T, chromosome 2 at 85,488,765 bp
  • T to C, chromosome 2 at 89,880,961 bp
  • C to T, chromosome 3 at 95,784,247 bp
  • T to A, chromosome 3 at 96,057,024 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • A to G, chromosome 4 at 137,644,470 bp
  • G to A, chromosome 5 at 96,726,543 bp
  • T to A, chromosome 6 at 7,983,164 bp
  • T to C, chromosome 6 at 76,496,415 bp
  • G to A, chromosome 6 at 85,203,919 bp
  • C to T, chromosome 7 at 96,955,931 bp
  • T to G, chromosome 7 at 123,401,439 bp
  • A to G, chromosome 8 at 3,613,667 bp
  • ATATTTATTTATTTATTTATTTATTTATTTATT to ATATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 8 at 53,609,369 bp
  • A to G, chromosome 8 at 63,931,335 bp
  • A to T, chromosome 8 at 123,274,186 bp
  • A to T, chromosome 9 at 20,872,962 bp
  • T to C, chromosome 9 at 108,733,276 bp
  • A to G, chromosome 10 at 4,746,781 bp
  • A to T, chromosome 10 at 56,161,147 bp
  • A to G, chromosome 11 at 6,619,008 bp
  • T to C, chromosome 11 at 22,095,883 bp
  • A to G, chromosome 11 at 73,712,083 bp
  • A to G, chromosome 11 at 96,195,973 bp
  • T to C, chromosome 13 at 46,696,772 bp
  • T to C, chromosome 13 at 59,500,602 bp
  • T to C, chromosome 14 at 105,893,587 bp
  • A to G, chromosome 15 at 5,100,286 bp
  • A to G, chromosome 15 at 47,675,739 bp
  • T to G, chromosome 15 at 85,903,288 bp
  • T to C, chromosome 15 at 100,304,958 bp
  • A to T, chromosome 17 at 20,471,135 bp
  • A to G, chromosome 18 at 75,286,769 bp
  • T to C, chromosome 18 at 84,015,231 bp
  • C to A, chromosome 19 at 13,341,793 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0943 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039082-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.