Strain Name:
C57BL/6J-MtgxR0943Btlr/Mmmh
Stock Number:
039082-MU
Citation ID:
RRID:MMRRC_039082-MU
Other Names:
R0943 (G1), C57BL/6J-MtgxR0943Btlr
Major Collection:

Gene Information

Gene Symbol: Prkar2a [MGI:108025] (Mus musculus (mouse))
Name: protein kinase, cAMP dependent regulatory, type II alpha
Synonyms: 1110061A24Rik, RII(alpha)
Chromosome: 9
Alteration at locus: Chemically Induced
Gene Symbol: Spry2 [MGI:1345138] (Mus musculus (mouse))
Name: sprouty RTK signaling antagonist 2
Synonyms: sprouty2
Chromosome: 14
Alteration at locus: Chemically Induced
Gene Symbol: Emx1 [MGI:95387] (Mus musculus (mouse))
Name: empty spiracles homeobox 1
Chromosome: 6
Alteration at locus: Chemically Induced
Gene Symbol: Rprd2 [MGI:1922387] (Mus musculus (mouse))
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 4930535B03Rik, 2810036A19Rik
Chromosome: 3
Alteration at locus: Chemically Induced
Gene Symbol: Lcmt1 [MGI:1353593] (Mus musculus (mouse))
Name: leucine carboxyl methyltransferase 1
Synonyms: LCMT-1, Lcmt
Chromosome: 7
Alteration at locus: Chemically Induced
Gene Symbol: Usp48 [MGI:2158502] (Mus musculus (mouse))
Name: ubiquitin specific peptidase 48
Synonyms: Usp31, 2810449C13Rik, D330022K21Rik
Chromosome: 4
Alteration at locus: Chemically Induced
Gene Symbol: Esr1 [MGI:1352467] (Mus musculus (mouse))
Name: estrogen receptor 1 (alpha)
Synonyms: Nr3a1, ER[a], Estra, Estr, ERa, ERalpha, ER-alpha, ESR
Chromosome: 10
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 131,528,779 bp
  • T to C, chromosome 1 at 138,111,164 bp
  • GCCACCA to GCCA, chromosome 2 at 52,110,324 bp
  • T to A, chromosome 2 at 83,917,998 bp
  • C to T, chromosome 2 at 85,488,765 bp
  • T to C, chromosome 2 at 89,880,961 bp
  • C to T, chromosome 3 at 95,784,247 bp
  • T to A, chromosome 3 at 96,057,024 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • A to G, chromosome 4 at 137,644,470 bp
  • G to A, chromosome 5 at 96,726,543 bp
  • T to A, chromosome 6 at 7,983,164 bp
  • T to C, chromosome 6 at 76,496,415 bp
  • G to A, chromosome 6 at 85,203,919 bp
  • C to T, chromosome 7 at 96,955,931 bp
  • T to G, chromosome 7 at 123,401,439 bp
  • A to G, chromosome 8 at 3,613,667 bp
  • ATATTTATTTATTTATTTATTTATTTATTTATT to ATATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 8 at 53,609,369 bp
  • A to G, chromosome 8 at 63,931,335 bp
  • A to T, chromosome 8 at 123,274,186 bp
  • A to T, chromosome 9 at 20,872,962 bp
  • T to C, chromosome 9 at 108,733,276 bp
  • A to G, chromosome 10 at 4,746,781 bp
  • A to T, chromosome 10 at 56,161,147 bp
  • A to G, chromosome 11 at 6,619,008 bp
  • T to C, chromosome 11 at 22,095,883 bp
  • A to G, chromosome 11 at 73,712,083 bp
  • A to G, chromosome 11 at 96,195,973 bp
  • T to C, chromosome 13 at 46,696,772 bp
  • T to C, chromosome 13 at 59,500,602 bp
  • T to C, chromosome 14 at 105,893,587 bp
  • A to G, chromosome 15 at 5,100,286 bp
  • A to G, chromosome 15 at 47,675,739 bp
  • T to G, chromosome 15 at 85,903,288 bp
  • T to C, chromosome 15 at 100,304,958 bp
  • A to T, chromosome 17 at 20,471,135 bp
  • A to G, chromosome 18 at 75,286,769 bp
  • T to C, chromosome 18 at 84,015,231 bp
  • C to A, chromosome 19 at 13,341,793 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0943 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039082-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.