Strain Name:
C57BL/6J-MtgxR0988Btlr/Mmmh
Stock Number:
039108-MU
Citation ID:
RRID:MMRRC_039108-MU
Other Names:
R0988 (G1), C57BL/6J-MtgxR0988Btlr
Major Collection:

Strain Information

Macroh2a1
Name: macroH2A.1 histone
Synonyms: MACROH2A1.2, H2afy, H2AF12M, mH2a1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26914
HGNC: HGNC:4740
Homologene: 3598
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Micu1
Name: mitochondrial calcium uptake 1
Synonyms: Cbara1, C730016L05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216001
HGNC: HGNC:1530
Homologene: 4431
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, ALL-1, Mll1, Cxxc7, Mll, HTRX1, All1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Mfsd14b
Name: major facilitator superfamily domain containing 14B
Synonyms: 5730414C17Rik, Hiatl1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66631
Homologene: 64464
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Ephb2
Name: Eph receptor B2
Synonyms: eteck, Nuk, Cek5, Qek5, Prkm5, Sek3, Erk, Hek5, Drt, Tyro5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, 4732483H20Rik, 9630020C08Rik, steerin 3, unc53H3, POMFIL1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: p150, Vps15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Cst11
Name: cystatin 11
Synonyms: mCST E1, CRES2, cystatin E1, 9230101F08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78240
Homologene: 15634
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC5, 2300002I04Rik, MUC9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Serac1
Name: serine active site containing 1
Synonyms: 4930511N22Rik, D17Ertd141e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 321007
Homologene: 41900
Abcb5
Name: ATP-binding cassette, sub-family B member 5
Synonyms: 9230106F14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77706
HGNC: HGNC:46
Homologene: 83488
Proc
Name: protein C
Synonyms: PC, inactivator of coagulation factors Va, VIII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19123
VEGA: 18
HGNC: HGNC:9451
Homologene: 37288
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Lgmn
Name: legumain
Synonyms: preprolegumain, Prsc1, AEP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19141
HGNC: HGNC:9472
Homologene: 38075
Hpn
Name: hepsin
Synonyms: Hlb320
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15451
HGNC: HGNC:5155
Homologene: 20498
Napg
Name: N-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms: SNARE, 2400003O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108123
HGNC: HGNC:7642
Homologene: 2838
Or5b99
Name: olfactory receptor family 5 subfamily B member 99
Synonyms: Olfr1451, MOR202-1, GA_x6K02T2RE5P-3328502-3329434
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258700
HGNC: HGNC:8323
Homologene: 128082
1110020G09Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Thrb
Name: thyroid hormone receptor beta
Synonyms: T3Rbeta, c-erbAbeta, T3R[b], Nr1a2, TR beta, Thrb2, Thrb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21834
Homologene: 36025
Ntpcr
Name: nucleoside-triphosphatase, cancer-related
Synonyms: 2310079N02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66566
Homologene: 11989
Pdia2
Name: protein disulfide isomerase associated 2
Synonyms: Pdip, Pdipl, 1810041F13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69191
Homologene: 55994
Or6c214
Name: olfactory receptor family 6 subfamily C member 214
Synonyms: MOR117-1, Olfr807, GA_x6K02T2PULF-11434134-11433199
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258931
Homologene: 27300
4921506M07Rik
Name: RIKEN cDNA 4921506M07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Rragc
Name: Ras-related GTP binding C
Synonyms: YGR163W, Gtr2, TIB929
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54170
Homologene: 39141
Or51af1
Name: olfactory receptor family 51 subfamily AF member 1
Synonyms: Olfr609, MOR9-1, GA_x6K02T2PBJ9-6207735-6206776
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259086
Homologene: 64952
Or1j13
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258952
Homologene: 74160
Platr26
Name: pluripotency associated transcript 26
Synonyms: LOC381371, Gm1631
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381371
Zfp607b
Name: zinc finger protein 607B
Synonyms: C030039L03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 112415
Homologene: 134321
Snrpd3
Name: small nuclear ribonucleoprotein D3
Synonyms: SMD3, 2310009E13Rik, 1700043E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67332
Homologene: 3078
Krtap4-9
Name: keratin associated protein 4-9
Synonyms: OTTMUSG00000002198
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 665998
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 159,232,847 bp
  • A to G, chromosome 1 at 159,244,672 bp
  • T to C, chromosome 2 at 31,335,451 bp
  • T to C, chromosome 2 at 36,479,767 bp
  • A to T, chromosome 2 at 71,723,287 bp
  • G to A, chromosome 2 at 148,770,426 bp
  • T to A, chromosome 4 at 123,924,782 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • T to A, chromosome 4 at 136,659,708 bp
  • T to A, chromosome 7 at 27,702,976 bp
  • T to C, chromosome 7 at 31,099,898 bp
  • T to A, chromosome 7 at 103,492,747 bp
  • A to G, chromosome 7 at 141,871,795 bp
  • T to G, chromosome 7 at 144,633,653 bp
  • T to C, chromosome 8 at 125,737,431 bp
  • A to G, chromosome 9 at 44,848,549 bp
  • A to G, chromosome 9 at 105,687,205 bp
  • C to T, chromosome 9 at 110,388,777 bp
  • C to A, chromosome 10 at 59,756,727 bp
  • A to G, chromosome 10 at 75,532,205 bp
  • G to A, chromosome 10 at 109,716,528 bp
  • A to G, chromosome 10 at 129,754,997 bp
  • T to A, chromosome 11 at 99,785,536 bp
  • T to C, chromosome 12 at 57,688,649 bp
  • T to C, chromosome 12 at 102,398,277 bp
  • T to C, chromosome 12 at 118,932,575 bp
  • T to C, chromosome 13 at 56,083,296 bp
  • T to C, chromosome 13 at 65,112,493 bp
  • G to T, chromosome 14 at 17,981,837 bp
  • T to A, chromosome 15 at 9,102,992 bp
  • A to T, chromosome 17 at 6,061,580 bp
  • A to G, chromosome 17 at 26,198,829 bp
  • T to C, chromosome 18 at 32,133,483 bp
  • T to C, chromosome 18 at 62,983,360 bp
  • A to G, chromosome 19 at 12,999,787 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0988 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039108-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.