Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0993Btlr/Mmmh
Stock Number:
039113-MU
Citation ID:
RRID:MMRRC_039113-MU
Other Names:
R0993 (G1), C57BL/6J-MtgxR0993Btlr
Major Collection:

Strain Information

Foxp4
Name: forkhead box P4
Synonyms: 1200010K03Rik, 2310007G05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74123
Homologene: 12536
Slc32a1
Name: solute carrier family 32 (GABA vesicular transporter), member 1
Synonyms: R75019, VGAT, Viaat
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22348
Homologene: 56451
Etv1
Name: ets variant 1
Synonyms: ER81, Etsrp81
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14009
HGNC: HGNC:3490
Homologene: 3636
Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Polr1has
Name: RNA polymerase I subunit H, antisense
Synonyms: 1700022C21Rik, Znrd1as
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76416
Homologene: 130062
Lmbr1
Name: limb region 1
Synonyms: 1110048D14Rik, C79130
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56873
Homologene: 49706
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Samd8
Name: sterile alpha motif domain containing 8
Synonyms: 1700010P07Rik, 1110053F04Rik, Smsr
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67630
Homologene: 41670
Nup58
Name: nucleoporin 58
Synonyms: 1700017F11Rik, Nupl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71844
VEGA: 14
Homologene: 40924
Nrbp1
Name: nuclear receptor binding protein 1
Synonyms: B230344L17Rik, Nrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192292
HGNC: HGNC:7993
Homologene: 8373
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Shf
Name: Src homology 2 domain containing F
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 435684
Homologene: 44524
Dgkg
Name: diacylglycerol kinase, gamma
Synonyms: Dagk3, E430001K23Rik, 2900055E17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110197
HGNC: HGNC:2853
Homologene: 1029
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Slx4
Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms: D16Bwg1016e, Btbd12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52864
Homologene: 23770
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Slc2a9
Name: solute carrier family 2 (facilitated glucose transporter), member 9
Synonyms: Glut9, SLC2A9B, SLC2a9A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117591
Homologene: 69290
Or8j3b
Name: olfactory receptor family 8 subfamily J member 3B
Synonyms: GA_x6K02T2Q125-47844843-47843896, MOR185-11, Olfr1057
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404325
Homologene: 83135
D6Ertd527e
Name: DNA segment, Chr 6, ERATO Doi 527, expressed
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52372
Tha1
Name: threonine aldolase 1
Synonyms: GLY1, 1300017K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71776
Homologene: 57081
Prl2c2
Name: prolactin family 2, subfamily c, member 2
Synonyms: MRP-1, PLF-1, Plf, Plf1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18811
VEGA: 13
Homologene: 40763
AC132379.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Fbxl8
Name: F-box and leucine-rich repeat protein 8
Synonyms: FBL8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50788
Homologene: 9279
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 116,821,825 bp
  • T to G, chromosome 2 at 86,374,878 bp
  • T to C, chromosome 2 at 120,705,169 bp
  • G to A, chromosome 2 at 122,368,682 bp
  • T to C, chromosome 2 at 158,611,420 bp
  • T to C, chromosome 4 at 43,549,825 bp
  • C to A, chromosome 4 at 117,564,663 bp
  • G to A, chromosome 4 at 145,117,692 bp
  • T to A, chromosome 5 at 29,287,393 bp
  • T to A, chromosome 5 at 31,245,813 bp
  • T to A, chromosome 5 at 38,382,063 bp
  • C to G, chromosome 6 at 87,111,524 bp
  • C to A, chromosome 8 at 105,267,085 bp
  • G to A, chromosome 9 at 108,843,536 bp
  • G to A, chromosome 11 at 117,870,999 bp
  • C to T, chromosome 12 at 38,827,864 bp
  • T to C, chromosome 12 at 98,861,183 bp
  • G to C, chromosome 13 at 13,002,201 bp
  • T to A, chromosome 14 at 21,775,495 bp
  • A to T, chromosome 14 at 60,244,670 bp
  • T to C, chromosome 16 at 3,985,825 bp
  • C to T, chromosome 16 at 22,584,497 bp
  • TCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCAC, chromosome 17 at 36,965,047 bp
  • G to C, chromosome 17 at 47,880,353 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0993 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039113-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.