Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1022Btlr/Mmmh
Stock Number:
039124-MU
Citation ID:
RRID:MMRRC_039124-MU
Other Names:
R1022 (G1), C57BL/6J-MtgxR1022Btlr
Major Collection:

Strain Information

Otx2
Name: orthodenticle homeobox 2
Synonyms: E130306E05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18424
HGNC: HGNC:8522
Homologene: 11026
Drd1
Name: dopamine receptor D1
Synonyms: D1 receptor, Gpcr15, Drd-1, C030036C15Rik, Drd1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13488
VEGA: 13
HGNC: HGNC:3020
Homologene: 30992
Syt3
Name: synaptotagmin III
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20981
Homologene: 9617
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 2410095B20Rik, 4931431C02Rik, C330023D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Epb41
Name: erythrocyte membrane protein band 4.1
Synonyms: 4.1R, Elp-1, Elp1, D4Ertd442e, Epb4.1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269587
HGNC: HGNC:3377
Homologene: 44324
Utp6
Name: UTP6 small subunit processome component
Synonyms: HCA66, 4732497O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216987
Homologene: 41265
Atxn2l
Name: ataxin 2-like
Synonyms: A2RP, A2LG, A2D, A2lp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233871
Homologene: 16513
Ccar2
Name: cell cycle activator and apoptosis regulator 2
Synonyms: 2610301G19Rik, Dbc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219158
VEGA: 14
Homologene: 10910
Hnrnpd
Name: heterogeneous nuclear ribonucleoprotein D
Synonyms: Auf1, Hnrpd
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11991
HGNC: HGNC:5036
Homologene: 22410
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Nop2
Name: NOP2 nucleolar protein
Synonyms: 120kDa, Nol1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110109
HGNC: HGNC:7867
Homologene: 135865
Tut1
Name: terminal uridylyl transferase 1, U6 snRNA-specific
Synonyms: PAPD2, 2700038E08Rik, Rbm21, TUTase6, Tent1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70044
VEGA: 19
Homologene: 69361
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: A930007H10Rik, C820010P03Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Stxbp1
Name: syntaxin binding protein 1
Synonyms: Munc-18a, Sxtbp1, Munc18-1, Unc18h, Rb-sec1, N-sec1, nsec1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20910
Homologene: 2382
Tatdn2
Name: TatD DNase domain containing 2
Synonyms: mKIAA0218
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381801
Homologene: 8848
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Slc7a2
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 2
Synonyms: Tea, Atrc2, Cat2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11988
Homologene: 20659
Nell1
Name: NEL-like 1
Synonyms: B230343H07Rik, l7R6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338352
HGNC: HGNC:7750
Homologene: 4486
Nudt8
Name: nudix hydrolase 8
Synonyms: 2310039H17Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 8
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66387
VEGA: 19
HGNC: HGNC:8055
Homologene: 41633
Slc5a3
Name: solute carrier family 5 (inositol transporters), member 3
Synonyms: Smit1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 53881
Homologene: 31412
Pth1r
Name: parathyroid hormone 1 receptor
Synonyms: PTH-related peptide receptor, PPR, PTH1R, PTH/PTHrP receptor, Pthr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19228
HGNC: HGNC:9608
Homologene: 267
Folr1
Name: folate receptor alpha
Synonyms: FBP1, folate receptor [a], folate-binding protein 1, Folbp1, Folbp-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14275
HGNC: HGNC:3791
Homologene: 7322
Cog2
Name: component of oligomeric golgi complex 2
Synonyms: 1190002B08Rik, 2700012E02Rik, Cog2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76332
HGNC: HGNC:6546
Homologene: 7206
Hpd
Name: 4-hydroxyphenylpyruvic acid dioxygenase
Synonyms: Hppd, Laf, Flp, Fla
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15445
HGNC: HGNC:5147
Homologene: 1620
Or4k5
Name: olfactory receptor family 4 subfamily K member 5
Synonyms: GA_x6K02T2PMLR-5839874-5838903, MOR246-6, Olfr729
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258275
Homologene: 17167
Vmn2r90
Name: vomeronasal 2, receptor 90
Synonyms: EG626942
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 626942
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Acap3
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Synonyms: Kiaa1716-hp, Centb5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140500
Homologene: 23708
Prl5a1
Name: prolactin family 5, subfamily a, member 1
Synonyms: 1600013P04Rik, PLP-L, D13Wsu14e, Prlpl
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 28078
Homologene: 11378
Cdc14b
Name: CDC14 cell division cycle 14B
Synonyms: 2810432N10Rik, A530086E13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218294
VEGA: 13
Homologene: 104197
Cfap100
Name: cilia and flagella associated protein 100
Synonyms: C030041G11Rik, C230069K22Rik, Ccdc37
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243538
Homologene: 18456
Dqx1
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93838
Homologene: 14143
Sirt5
Name: sirtuin 5
Synonyms: 0610012J09Rik, 1500032M05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68346
VEGA: 13
Homologene: 40825
H1f7
Name: H1.7 linker histone
Synonyms: 1700026P10Rik, H1T2, H1fnt, H1-7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70069
VEGA: 15
Fmo4
Name: flavin containing monooxygenase 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226564
HGNC: HGNC:3772
Homologene: 68219
Map4k2
Name: mitogen-activated protein kinase kinase kinase kinase 2
Synonyms: BL44, Rab8ip
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26412
HGNC: HGNC:6864
Homologene: 3370
Trpv6
Name: transient receptor potential cation channel, subfamily V, member 6
Synonyms: CaT1, Cac, CAT, Ecac2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64177
Homologene: 56812
AL773549.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Gatc
Name: glutamyl-tRNA amidotransferase subunit C
Synonyms: 2010003O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384281
Homologene: 19922
4930433N12Rik
Name: RIKEN cDNA 4930433N12 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 114673
Rwdd2b
Name: RWD domain containing 2B
Synonyms: ORF5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 53858
HGNC: HGNC:1302
Homologene: 9654
Igfals
Name: insulin-like growth factor binding protein, acid labile subunit
Synonyms: ALS, Albs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16005
VEGA: 17
HGNC: HGNC:5468
Homologene: 37987
Marchf2
Name: membrane associated ring-CH-type finger 2
Synonyms: 9530046H09Rik, March2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224703
Homologene: 9539
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 36,184,342 bp
  • T to A, chromosome 1 at 162,805,144 bp
  • T to C, chromosome 2 at 32,814,967 bp
  • G to A, chromosome 2 at 67,433,011 bp
  • C to T, chromosome 4 at 132,003,577 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • T to C, chromosome 4 at 155,901,862 bp
  • C to A, chromosome 5 at 99,966,157 bp
  • T to A, chromosome 5 at 115,340,845 bp
  • C to T, chromosome 5 at 123,174,469 bp
  • G to A, chromosome 6 at 41,623,870 bp
  • G to A, chromosome 6 at 83,061,089 bp
  • T to A, chromosome 6 at 90,413,004 bp
  • A to G, chromosome 6 at 113,709,545 bp
  • T to A, chromosome 6 at 125,137,186 bp
  • G to T, chromosome 7 at 44,390,682 bp
  • A to G, chromosome 7 at 50,120,663 bp
  • A to G, chromosome 7 at 101,858,603 bp
  • A to T, chromosome 7 at 126,497,294 bp
  • A to G, chromosome 7 at 130,509,000 bp
  • T to C, chromosome 8 at 40,915,034 bp
  • G to A, chromosome 8 at 124,529,066 bp
  • C to T, chromosome 9 at 3,134,019 bp
  • A to T, chromosome 9 at 21,833,612 bp
  • T to C, chromosome 9 at 110,729,621 bp
  • A to T, chromosome 9 at 110,742,227 bp
  • A to G, chromosome 9 at 119,609,274 bp
  • A to T, chromosome 11 at 60,479,616 bp
  • A to T, chromosome 11 at 79,547,033 bp
  • T to C, chromosome 11 at 79,960,732 bp
  • T to A, chromosome 12 at 70,252,017 bp
  • G to A, chromosome 13 at 28,149,897 bp
  • A to G, chromosome 13 at 43,370,769 bp
  • T to A, chromosome 13 at 54,053,314 bp
  • A to T, chromosome 13 at 64,215,676 bp
  • A to T, chromosome 13 at 98,732,659 bp
  • TCTGCTGCTGCTGCTGCTG to TCTGCTGCTGCTGCTG, chromosome 14 at 48,659,272 bp
  • A to T, chromosome 14 at 50,147,927 bp
  • A to G, chromosome 14 at 70,140,515 bp
  • G to A, chromosome 15 at 98,256,755 bp
  • A to T, chromosome 16 at 87,436,850 bp
  • G to A, chromosome 16 at 92,077,495 bp
  • A to T, chromosome 17 at 17,728,138 bp
  • G to A, chromosome 17 at 24,880,483 bp
  • C to A, chromosome 17 at 33,709,788 bp
  • T to A, chromosome 19 at 4,001,925 bp
  • A to G, chromosome 19 at 6,344,575 bp
  • A to G, chromosome 19 at 8,959,355 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1022 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039124-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.