Strain Name:
C57BL/6J-MtgxR1035Btlr/Mmmh
Stock Number:
039134-MU
Citation ID:
RRID:MMRRC_039134-MU
Other Names:
R1035 (G1), C57BL/6J-MtgxR1035Btlr
Major Collection:

Strain Information

Tmprss12
Name: transmembrane (C-terminal) protease, serine 12
Synonyms: 4930478A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 75002
VEGA: 15
Homologene: 16598
Aasdh
Name: aminoadipate-semialdehyde dehydrogenase
Synonyms: A230062G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231326
Homologene: 71711
Stk17b
Name: serine/threonine kinase 17b (apoptosis-inducing)
Synonyms: Drak2, 3110009A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98267
Homologene: 31231
Dctn1
Name: dynactin 1
Synonyms: p150, p150glued, Glued
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13191
HGNC: HGNC:2711
Homologene: 3011
Polr1a
Name: polymerase (RNA) I polypeptide A
Synonyms: 2900087K15Rik, Rpo1-4, 3010014K16Rik, RPA194, 194kDa, mRPA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20019
Homologene: 7033
Chek1
Name: checkpoint kinase 1
Synonyms: Chk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12649
HGNC: HGNC:1925
Homologene: 975
Cbln4
Name: cerebellin 4 precursor protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228942
Homologene: 15419
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, C230079D11Rik, D430002O22Rik, D930044O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 211961
Homologene: 19371
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Myo15a
Name: myosin XVA
Synonyms: Myo15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 53867
Homologene: 9253
Nlrp9c
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp9c, Nalp-zeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330490
Homologene: 116072
Ggt7
Name: gamma-glutamyltransferase 7
Synonyms: 6330563L03Rik, Ggtl3, 1110017C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 207182
HGNC: HGNC:4259
Homologene: 70866
Cyp2b10
Name: cytochrome P450, family 2, subfamily b, polypeptide 10
Synonyms: Cyp2b, p16, phenobarbitol inducible, type b, Cyp2b20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13088
HGNC: HGNC:2615
Homologene: 73894
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Or5ac19
Name: olfactory receptor family 5 subfamily AC member 19
Synonyms: Olfr201, MOR182-2, GA_x54KRFPKG5P-55483936-55483010
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258996
Homologene: 37011
Cadm2
Name: cell adhesion molecule 2
Synonyms: Igsf4d, Necl3, A830029E02Rik, SynCAM2, 2900078E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239857
Homologene: 17705
Entpd6
Name: ectonucleoside triphosphate diphosphohydrolase 6
Synonyms: NTPDase-6, 2700026H11Rik, Cd39l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12497
HGNC: HGNC:3368
Homologene: 68170
Caskin1
Name: CASK interacting protein 1
Synonyms: C630036E02Rik, 3300002N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268932
VEGA: 17
Homologene: 25873
Spmap2
Name: sperm microtubule associated protein 2
Synonyms: Theg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 21830
Homologene: 7976
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Vmn2r98
Name: vomeronasal 2, receptor 98
Synonyms: EG224552
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224552
Homologene: 115024
Nrxn1
Name: neurexin I
Synonyms: 1700062G21Rik, neurexin I beta, 9330127H16Rik, neurexin I beta, neurexin I alpha, neurexin I alpha, A230068P09Rik, neurexin I alpha, neurexin I beta, alpha-latrotoxin receptor (calcium-dependent)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Tas2r143
Name: taste receptor, type 2, member 143
Synonyms: mt2r36, Tas2r43
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387514
Homologene: 74285
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Ear2
Name: eosinophil-associated, ribonuclease A family, member 2
Synonyms: eosinophil-derived neurotoxin, liver, Rnase2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13587
Homologene: 40596
Ppig
Name: peptidyl-prolyl isomerase G (cyclophilin G)
Synonyms: B230312B02Rik, SRCyp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228005
Homologene: 3520
Fam98b
Name: family with sequence similarity 98, member B
Synonyms: 2610510H03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68215
Homologene: 72241
Zfp78
Name: zinc finger protein 78
Synonyms: Zfp77, KRAB12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330463
Homologene: 128524
Txndc16
Name: thioredoxin domain containing 16
Synonyms: 5730420B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 70561
Homologene: 18197
Pcsk1
Name: proprotein convertase subtilisin/kexin type 1
Synonyms: PC3, PC1, SPC3, Nec-1, Phpp-1, prohormone convertase 1/3, Nec1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18548
HGNC: HGNC:8743
Homologene: 379
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 14,891,303 bp
  • A to G, chromosome 1 at 46,124,448 bp
  • T to C, chromosome 1 at 53,762,599 bp
  • T to C, chromosome 2 at 69,749,459 bp
  • C to T, chromosome 2 at 117,270,639 bp
  • T to A, chromosome 2 at 150,764,192 bp
  • A to T, chromosome 2 at 155,506,427 bp
  • T to C, chromosome 2 at 172,042,069 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • G to A, chromosome 5 at 76,876,283 bp
  • A to T, chromosome 6 at 42,400,265 bp
  • T to C, chromosome 6 at 71,967,916 bp
  • T to C, chromosome 6 at 83,190,220 bp
  • G to T, chromosome 7 at 6,378,661 bp
  • C to T, chromosome 7 at 25,917,048 bp
  • C to T, chromosome 7 at 26,371,277 bp
  • A to T, chromosome 7 at 81,463,911 bp
  • A to T, chromosome 9 at 20,793,499 bp
  • A to G, chromosome 9 at 36,716,473 bp
  • G to A, chromosome 10 at 79,583,850 bp
  • T to C, chromosome 11 at 60,510,558 bp
  • T to C, chromosome 13 at 75,132,119 bp
  • A to T, chromosome 14 at 44,102,887 bp
  • A to G, chromosome 14 at 45,172,563 bp
  • G to A, chromosome 15 at 100,285,200 bp
  • C to T, chromosome 16 at 59,268,944 bp
  • A to T, chromosome 16 at 66,815,347 bp
  • T to C, chromosome 17 at 19,080,749 bp
  • A to G, chromosome 17 at 24,505,037 bp
  • A to T, chromosome 17 at 90,163,874 bp
  • T to C, chromosome 18 at 22,525,049 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1035 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039134-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.