Strain Name:
C57BL/6J-MtgxR1106Btlr/Mmmh
Stock Number:
039179-MU
Citation ID:
RRID:MMRRC_039179-MU
Other Names:
R1106 (G1), C57BL/6J-MtgxR1106Btlr
Major Collection:

Gene Information

Ptprz1
Name: protein tyrosine phosphatase, receptor type Z, polypeptide 1
Synonyms: PTPbeta, DSD-1-PG, Ptprz, Ptpz, Rptpbeta, PTPzeta, RPTPz, phosphacan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Gnai2
Name: guanine nucleotide binding protein (G protein), alpha inhibiting 2
Synonyms: Galphai2, Gia, Gnai-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 14678
HGNC: HGNC:4385
Homologene: 55539
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Mier3
Name: MIER family member 3
Synonyms: D130064H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218613
Homologene: 18196
Cfap20
Name: cilia and flagella associated protein 20
Synonyms: T10-2A2, Gtl3, 2600014O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 14894
Homologene: 7350
Caml
Name: calcium modulating ligand
Synonyms: Caml
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 12328
HGNC: HGNC:1471
Homologene: 1323
Zik1
Name: zinc finger protein interacting with K protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 22775
Homologene: 32076
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 329559
Homologene: 11129
Rpl7
Name: ribosomal protein L7
Synonyms: Rpl7a, Surf-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19989
Homologene: 87772
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Col1a-2, Cola-2, Cola2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Slc9c1
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 208169
Homologene: 19505
Ush2a
Name: usherin
Synonyms: Ush2a, Ushrn, MUSH2A, A930037M10Rik, A930011D15Rik, LOC269160, LOC381317
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22283
Homologene: 66151
Samd3
Name: sterile alpha motif domain containing 3
Synonyms: LOC268288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 268288
VEGA: 10
Homologene: 67991
Vps37a
Name: vacuolar protein sorting 37A
Synonyms: 4930592A21Rik, 2210018P21Rik, D8Ertd531e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 52348
VEGA: 8
Homologene: 45120
Olfr1189
Name: olfactory receptor 1189
Synonyms: GA_x6K02T2Q125-50079044-50079964, MOR237-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258768
Homologene: 81569
Dio2
Name: deiodinase, iodothyronine, type II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 13371
VEGA: 12
HGNC: HGNC:2884
Homologene: 621
Olfr1384
Name: olfactory receptor 1384
Synonyms: MOR256-23, GA_x6K02T2QP88-5922712-5921756
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 258464
Homologene: 74259
Asic5
Name: acid-sensing (proton-gated) ion channel family member 5
Synonyms: brain-liver-intestine amiloride-sensitive sodium channel, Accn5, BLINaC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 58170
Homologene: 41171
Tas2r139
Name: taste receptor, type 2, member 139
Synonyms: Tas2r39, mt2r34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 353148
Homologene: 52214
Txndc16
Name: thioredoxin domain containing 16
Synonyms: 5730420B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 70561
Homologene: 18197
Syce1
Name: synaptonemal complex central element protein 1
Synonyms: 4933406J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 74075
Homologene: 77044
Klk1b16
Name: kallikrein 1-related peptidase b16
Synonyms: mGk-16, Klk16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 16615
HGNC: HGNC:6364
Homologene: 68141
Hexim2
Name: hexamethylene bis-acetamide inducible 2
Synonyms: 4933402L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 71059
Homologene: 16946
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 16,104,358 bp
  • G to A, chromosome 1 at 188,910,983 bp
  • T to C, chromosome 2 at 88,592,011 bp
  • TTGCTGCTGCTGCTGCTGCT to TTGCTGCTGCTGCTGCT, chromosome 2 at 164,907,551 bp
  • C to A, chromosome 3 at 82,004,590 bp
  • G to A, chromosome 6 at 4,518,822 bp
  • A to G, chromosome 6 at 22,965,749 bp
  • A to G, chromosome 6 at 42,141,545 bp
  • G to A, chromosome 6 at 137,514,324 bp
  • G to A, chromosome 7 at 10,490,385 bp
  • C to T, chromosome 7 at 44,139,513 bp
  • C to A, chromosome 7 at 140,779,896 bp
  • T to A, chromosome 8 at 40,512,206 bp
  • A to T, chromosome 8 at 95,421,245 bp
  • A to G, chromosome 9 at 107,620,186 bp
  • G to A, chromosome 10 at 26,271,791 bp
  • A to G, chromosome 11 at 49,513,692 bp
  • T to C, chromosome 11 at 103,138,493 bp
  • A to G, chromosome 12 at 90,738,211 bp
  • A to G, chromosome 13 at 55,624,725 bp
  • A to T, chromosome 13 at 111,708,229 bp
  • A to G, chromosome 14 at 45,163,060 bp
  • C to A, chromosome 16 at 45,555,807 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1106 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039179-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.