Strain Name:
C57BL/6J-MtgxR1132Btlr/Mmmh
Stock Number:
039205-MU
Citation ID:
RRID:MMRRC_039205-MU
Other Names:
R1132 (G1), C57BL/6J-MtgxR1132Btlr
Major Collection:

Gene Information

Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Cdk8
Name: cyclin-dependent kinase 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 264064
HGNC: HGNC:1779
Homologene: 55565
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: 2610315D21Rik, FKBP-rapamycin-associated protein FRAP, RAPT1, Frap1, mechanistic target of rapamycin (serine/threonine kinase), flat, RAFT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Fbxo31
Name: F-box protein 31
Synonyms: 1110003O08Rik, Fbx14, Fbxo14, 2310046N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76454
Homologene: 11684
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545389
Homologene: 22844
Atxn2l
Name: ataxin 2-like
Synonyms: A2D, A2LG, A2lp, A2RP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233871
Homologene: 16513
Rbbp6
Name: retinoblastoma binding protein 6, ubiquitin ligase
Synonyms: 4933422O15Rik, C030034J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19647
HGNC: HGNC:9889
Homologene: 136812
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Zfp961
Name: zinc finger protein 961
Synonyms: BC049349, A230105L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234413
Homologene: 136286
Tfap2a
Name: transcription factor AP-2, alpha
Synonyms: Ap2, AP2alpha, AP-2 alpha, Ap-2 (a), Tcfap2a, Ap2tf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 21418
VEGA: 13
Homologene: 2421
Inpp5j
Name: inositol polyphosphate 5-phosphatase J
Synonyms: Pipp, Pib5pa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 170835
HGNC: HGNC:8956
Homologene: 8682
C3
Name: complement component 3
Synonyms: acylation stimulating protein, Plp, complement factor 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Car9
Name: carbonic anhydrase 9
Synonyms: MN/CA9, CAIX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230099
HGNC: HGNC:1383
Homologene: 20325
Itsn2
Name: intersectin 2
Synonyms: Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3d1B, Sh3p18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Prdm4
Name: PR domain containing 4
Synonyms: SC1, 1700031E19Rik, SC-1, 2810470D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 72843
VEGA: 10
HGNC: HGNC:9348
Homologene: 8235
Sec63
Name: SEC63-like (S. cerevisiae)
Synonyms: 5730478J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 140740
Homologene: 5220
Dhx37
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 37
Synonyms: LOC381671, LOC208144
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208144
Homologene: 6641
Trhde
Name: TRH-degrading enzyme
Synonyms: 9330155P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237553
Homologene: 75007
Cib1
Name: calcium and integrin binding 1 (calmyrin)
Synonyms: Kip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 23991
Homologene: 4654
Zdhhc25
Name: zinc finger, DHHC domain containing 25
Synonyms: 1700030J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 70073
Homologene: 19298
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240411
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: Myhsp, 4832426G23Rik, Myhs-p, MyHC-pn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Slc38a4
Name: solute carrier family 38, member 4
Synonyms: 1110012E16Rik, Ata3, 1700012A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69354
VEGA: 15
Homologene: 75077
Kif1a
Name: kinesin family member 1A
Synonyms: C630002N23Rik, Kns1, ATSV, N-3 kinesin, LOC381283
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Stac3
Name: SH3 and cysteine rich domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237611
Homologene: 17039
Apba1
Name: amyloid beta (A4) precursor protein binding, family A, member 1
Synonyms: X11alpha, 6430513E09Rik, Mint1, X11, Lin-10, Mint
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 319924
VEGA: 19
HGNC: HGNC:578
Homologene: 897
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230622
Homologene: 135888
Vmn1r22
Name: vomeronasal 1 receptor 22
Synonyms: V1rc23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171196
Homologene: 110825
Zfp202
Name: zinc finger protein 202
Synonyms: C130037E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 80902
Homologene: 68317
Vmn1r39
Name: vomeronasal 1 receptor 39
Synonyms: Gm5993
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 546903
Homologene: 110800
Olfr699
Name: olfactory receptor 699
Synonyms: GA_x6K02T2PBJ9-9168355-9167405, MOR283-10P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258180
Homologene: 79391
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Selenbp1
Name: selenium binding protein 1
Synonyms: Lp56, Lpsb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20341
Homologene: 2930
Cd163
Name: CD163 antigen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93671
HGNC: HGNC:1631
Homologene: 128811
Olfr298
Name: olfactory receptor 298
Synonyms: MOR219-4, GA_x6K02T2NHDJ-9619796-9620794
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 257905
Olfr101
Name: olfactory receptor 101
Synonyms: GA_x6K02T2PSCP-1761617-1760691, MOR250-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258831
HGNC: HGNC:8178
Homologene: 133728
Prss53
Name: protease, serine 53
Synonyms: BC039632
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330657
Homologene: 80097
Olfr115
Name: olfactory receptor 115
Synonyms: GA_x6K02T2PSCP-2070203-2069271, MOR218-11P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 257908
Homologene: 115497
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 93,056,021 bp
  • C to A, chromosome 1 at 176,750,037 bp
  • C to G, chromosome 3 at 94,937,333 bp
  • G to T, chromosome 4 at 43,512,439 bp
  • A to G, chromosome 4 at 112,898,099 bp
  • T to C, chromosome 4 at 148,551,030 bp
  • A to T, chromosome 5 at 125,421,039 bp
  • A to G, chromosome 5 at 146,299,815 bp
  • T to C, chromosome 6 at 57,900,841 bp
  • C to T, chromosome 6 at 66,804,444 bp
  • G to T, chromosome 6 at 124,309,096 bp
  • A to G, chromosome 7 at 80,228,030 bp
  • A to T, chromosome 7 at 86,489,217 bp
  • A to T, chromosome 7 at 106,790,551 bp
  • T to C, chromosome 7 at 119,939,004 bp
  • A to G, chromosome 7 at 123,000,113 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 7 at 126,494,248 bp
  • A to G, chromosome 7 at 127,888,287 bp
  • T to C, chromosome 8 at 71,965,788 bp
  • ACGGCGCGGCG to ACGGCGCGGCGCGGCG, chromosome 8 at 121,552,276 bp
  • CGCGG to CGCGGAGCGG, chromosome 8 at 121,552,280 bp
  • T to C, chromosome 9 at 40,211,022 bp
  • T to A, chromosome 10 at 42,828,888 bp
  • A to G, chromosome 10 at 85,899,281 bp
  • T to C, chromosome 10 at 114,412,478 bp
  • T to C, chromosome 10 at 127,507,259 bp
  • T to C, chromosome 11 at 3,502,305 bp
  • T to C, chromosome 11 at 53,694,961 bp
  • C to T, chromosome 11 at 67,297,131 bp
  • T to C, chromosome 11 at 119,285,059 bp
  • T to C, chromosome 12 at 4,658,464 bp
  • T to C, chromosome 13 at 40,721,391 bp
  • T to C, chromosome 15 at 88,600,723 bp
  • T to A, chromosome 15 at 97,016,115 bp
  • T to C, chromosome 17 at 37,299,532 bp
  • G to T, chromosome 17 at 37,610,442 bp
  • C to T, chromosome 17 at 57,207,531 bp
  • G to A, chromosome 17 at 58,294,356 bp
  • TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGA, chromosome 18 at 25,020,665 bp
  • T to C, chromosome 18 at 77,429,943 bp
  • T to C, chromosome 19 at 23,917,553 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1132 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039205-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.