Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1203Btlr/Mmmh
Stock Number:
039273-MU
Citation ID:
RRID:MMRRC_039273-MU
Other Names:
R1203 (G1), C57BL/6J-MtgxR1203Btlr
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Tead3
Name: TEA domain family member 3
Synonyms: ETFR-1, TEAD-3, DTEF-1, Tcf13r2, TEF-5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21678
Homologene: 81821
Tbcel
Name: tubulin folding cofactor E-like
Synonyms: E130107N23Rik, Lrrc35
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272589
Homologene: 16120
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Nsf
Name: N-ethylmaleimide sensitive fusion protein
Synonyms: SKD2, N-ethylmaleimide sensitive factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18195
HGNC: HGNC:8016
Homologene: 4502
Tbcd
Name: tubulin-specific chaperone d
Synonyms: A030005L14Rik, 2310057L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108903
Homologene: 4368
Sall1
Name: spalt like transcription factor 1
Synonyms: Msal-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 58198
Homologene: 2230
Zfp407
Name: zinc finger protein 407
Synonyms: LOC240469, LOC381139, 6430585N13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240476
Homologene: 86402
Atp6v1d
Name: ATPase, H+ transporting, lysosomal V1 subunit D
Synonyms: 1110004P10Rik, VATD, Atp6m, Vma8, lysosomal 34kDa
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73834
VEGA: 12
Homologene: 5783
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209018
Homologene: 44592
Fam171b
Name: family with sequence similarity 171, member B
Synonyms: D430039N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241520
Homologene: 18462
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Tmtc3
Name: transmembrane and tetratricopeptide repeat containing 3
Synonyms: 9130014E20Rik, B130008E12Rik, mSmile
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237500
Homologene: 27616
Eif2ak1
Name: eukaryotic translation initiation factor 2 alpha kinase 1
Synonyms: Hri
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15467
Homologene: 8290
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224170
Homologene: 8771
Atl2
Name: atlastin GTPase 2
Synonyms: Aip-2, 2010110I21Rik, Arl6ip2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56298
VEGA: 17
Homologene: 56949
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Kdm5d
Name: lysine demethylase 5D
Synonyms: Smcy, Jarid1d, HY
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 20592
Homologene: 55838
Gpr35
Name: G protein-coupled receptor 35
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64095
HGNC: HGNC:4492
Homologene: 3874
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Tbc1d17
Name: TBC1 domain family, member 17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233204
Homologene: 11656
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Tmem241
Name: transmembrane protein 241
Synonyms: 6030446N20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 338363
Homologene: 87267
Ncln
Name: nicalin
Synonyms: 3100002P13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103425
Homologene: 10604
Rnf43
Name: ring finger protein 43
Synonyms: 4732452J19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207742
Homologene: 37742
Aoah
Name: acyloxyacyl hydrolase
Synonyms: 4930433E13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27052
VEGA: 13
HGNC: HGNC:548
Homologene: 1238
Nphp4
Name: nephronophthisis 4 (juvenile) homolog (human)
Synonyms: 4930564O18Rik, nmf192
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 260305
Homologene: 9024
Or52h2
Name: olfactory receptor family 52 subfamily H member 2
Synonyms: GA_x6K02T2PBJ9-6924585-6923647, MOR31-7, Olfr649
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259057
Homologene: 74119
Tlcd5
Name: TLC domain containing 5
Synonyms: LOC235300, Tmem136
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235300
VEGA: 9
Homologene: 72560
Pabpc1l
Name: poly(A) binding protein, cytoplasmic 1-like
Synonyms: ePAB, 1810053B01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381404
Homologene: 77989
Aadacl3
Name: arylacetamide deacetylase like 3
Synonyms: LOC230883
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230883
Homologene: 28426
Aldh1b1
Name: aldehyde dehydrogenase 1 family, member B1
Synonyms: 2700007F14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72535
HGNC: HGNC:407
Homologene: 115470
Sgpp1
Name: sphingosine-1-phosphate phosphatase 1
Synonyms: mSPP1, SPP1, SPP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 81535
VEGA: 12
Homologene: 101696
Gm14137
Name: predicted gene 14137
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 623781
Homologene: 85847
Tedc2
Name: tubulin epsilon and delta complex 2
Synonyms: 1600002H07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72016
Homologene: 45943
Csrp3
Name: cysteine and glycine-rich protein 3
Synonyms: CRP3, muscle LIM protein, MLP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13009
HGNC: HGNC:2472
Homologene: 20742
Pcbd2
Name: pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Synonyms: Dcoh2, Dcohm, 2700061N24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72562
Homologene: 49987
Gm4950
Name: predicted pseudogene 4950
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240289
VEGA: 18
AC124724.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 11,518,594 bp
  • T to C, chromosome 1 at 92,983,148 bp
  • T to A, chromosome 2 at 83,812,969 bp
  • C to T, chromosome 2 at 119,175,124 bp
  • T to C, chromosome 2 at 121,372,123 bp
  • G to T, chromosome 2 at 164,037,171 bp
  • A to G, chromosome 4 at 45,803,359 bp
  • T to C, chromosome 4 at 144,463,570 bp
  • A to G, chromosome 4 at 152,488,832 bp
  • T to A, chromosome 5 at 124,760,014 bp
  • T to C, chromosome 5 at 143,883,979 bp
  • G to A, chromosome 7 at 44,843,471 bp
  • C to A, chromosome 7 at 48,839,530 bp
  • A to T, chromosome 7 at 104,189,853 bp
  • A to T, chromosome 8 at 89,031,934 bp
  • A to G, chromosome 9 at 37,418,682 bp
  • A to C, chromosome 9 at 42,451,651 bp
  • A to G, chromosome 9 at 43,111,480 bp
  • A to G, chromosome 10 at 12,486,537 bp
  • A to G, chromosome 10 at 81,496,193 bp
  • G to T, chromosome 10 at 100,476,744 bp
  • T to A, chromosome 11 at 54,691,699 bp
  • T to C, chromosome 11 at 87,727,475 bp
  • CAATAATAATAATAATA to CAATAATAATAATAATAATA, chromosome 11 at 103,926,126 bp
  • A to G, chromosome 11 at 121,475,625 bp
  • A to G, chromosome 12 at 75,716,282 bp
  • A to G, chromosome 12 at 78,861,440 bp
  • T to C, chromosome 12 at 117,933,812 bp
  • A to G, chromosome 13 at 20,816,594 bp
  • A to T, chromosome 13 at 24,099,006 bp
  • G to A, chromosome 13 at 55,733,068 bp
  • A to T, chromosome 15 at 8,157,760 bp
  • A to G, chromosome 15 at 64,746,931 bp
  • A to T, chromosome 16 at 21,511,557 bp
  • C to A, chromosome 16 at 32,754,529 bp
  • A to T, chromosome 16 at 48,951,817 bp
  • T to A, chromosome 17 at 24,216,317 bp
  • C to A, chromosome 17 at 24,216,318 bp
  • C to T, chromosome 17 at 28,341,562 bp
  • G to T, chromosome 17 at 79,852,905 bp
  • G to T, chromosome 18 at 12,083,978 bp
  • T to C, chromosome 18 at 51,865,758 bp
  • C to T, chromosome 18 at 84,559,773 bp
  • C to T, chromosome 19 at 47,155,400 bp
  • C to T, chromosome Y at 941,011 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1203 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039273-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.