Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1237Btlr/Mmmh
Stock Number:
039304-MU
Citation ID:
RRID:MMRRC_039304-MU
Other Names:
R1237 (G1), C57BL/6J-MtgxR1237Btlr
Major Collection:

Strain Information

Unc93b1
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54445
Homologene: 41325
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: 9330151F09Rik, Trap150, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Rps6ka5
Name: ribosomal protein S6 kinase, polypeptide 5
Synonyms: 6330404E13Rik, MSK1, 3110005L17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73086
VEGA: 12
Homologene: 48302
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Angptl1
Name: angiopoietin-like 1
Synonyms: ANGPT3, ANGY, ARP1, ANG3, 2810039D03Rik, ANG-3, ANG3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72713
HGNC: HGNC:489
Homologene: 128467
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Chd1l
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: Snf2p, 4432404A22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68058
HGNC: HGNC:1916
Homologene: 11590
Ibtk
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108837
Homologene: 34661
Ccdc174
Name: coiled-coil domain containing 174
Synonyms: C130022K22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232236
Homologene: 9523
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Skor2
Name: SKI family transcriptional corepressor 2
Synonyms: Fussel18, Corl2, Gm7348
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 664805
VEGA: 18
Homologene: 64797
Prf1
Name: perforin 1 (pore forming protein)
Synonyms: perforin, Prf-1, Pfp, Pfn
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18646
VEGA: 10
HGNC: HGNC:9360
Homologene: 3698
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Itga4
Name: integrin alpha 4
Synonyms: VLA-4 receptor, alpha 4 subunit
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16401
HGNC: HGNC:6140
Homologene: 37364
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Slc22a21
Name: solute carrier family 22 (organic cation transporter), member 21
Synonyms: Octn3, Slc22a9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56517
Homologene: 137336
Ddhd1
Name: DDHD domain containing 1
Synonyms: 9630061G18Rik, 4921528E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114874
Homologene: 35221
Ubtd2
Name: ubiquitin domain containing 2
Synonyms: 9630054F20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327900
Homologene: 15484
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625068
Homologene: 129606
Abcg3
Name: ATP binding cassette subfamily G member 3
Synonyms: Mxr2, Abcp2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27405
HGNC: HGNC:74
Homologene: 86845
Or2ad1
Name: olfactory receptor family 2 subfamily AD member 1
Synonyms: GA_x6K02T2QHY8-12104556-12105500, MOR256-15, Olfr1368
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258527
Homologene: 105156
Enthd1
Name: ENTH domain containing 1
Synonyms: LOC383075
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 383075
VEGA: 15
Homologene: 45131
Tas2r140
Name: taste receptor, type 2, member 140
Synonyms: TRB3, TRB5, mTRB3, Tas2r40, T2R40, mt2r64, Tas2r13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387616
Homologene: 87013
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22312
Homologene: 129750
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Ankrd13b
Name: ankyrin repeat domain 13b
Synonyms: B930093C12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268445
Homologene: 27367
Or2l5
Name: olfactory receptor family 2 subfamily L member 5
Synonyms: GA_x54KRFPKG5P-15963726-15962788, MOR272-1, Olfr167
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258937
Homologene: 78689
Prdx6b
Name: peroxiredoxin 6B
Synonyms: Aop2-rs1, 1-cysPrx-P1, 4930414C22Rik, Prdx6-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320769
Homologene: 71226
Vgll3
Name: vestigial like family member 3
Synonyms: 1700110N18Rik, Vito-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73569
VEGA: 16
Homologene: 53442
Vmn1r212
Name: vomeronasal 1 receptor 212
Synonyms: V1rh18
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171275
Homologene: 110880
Or12d12
Name: olfactory receptor family 12 subfamily D member 12
Synonyms: MOR250-2, GA_x6K02T2PSCP-1761617-1760691, Olfr101
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258831
Homologene: 133728
Amz1
Name: archaelysin family metallopeptidase 1
Synonyms: 6530401C20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231842
Homologene: 18290
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 156,858,584 bp
  • A to T, chromosome 2 at 66,680,295 bp
  • A to G, chromosome 2 at 79,279,146 bp
  • A to G, chromosome 2 at 80,293,176 bp
  • C to T, chromosome 3 at 97,582,731 bp
  • T to A, chromosome 4 at 21,730,457 bp
  • A to G, chromosome 4 at 126,180,069 bp
  • T to C, chromosome 5 at 104,948,357 bp
  • C to T, chromosome 5 at 121,321,507 bp
  • A to T, chromosome 5 at 140,741,284 bp
  • C to T, chromosome 6 at 91,890,787 bp
  • C to T, chromosome 6 at 118,612,625 bp
  • T to C, chromosome 6 at 133,055,208 bp
  • A to T, chromosome 8 at 45,044,279 bp
  • T to C, chromosome 9 at 85,720,748 bp
  • GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
  • A to C, chromosome 10 at 61,303,649 bp
  • T to A, chromosome 10 at 130,387,856 bp
  • C to T, chromosome 11 at 32,516,125 bp
  • A to G, chromosome 11 at 53,979,772 bp
  • T to C, chromosome 11 at 77,474,574 bp
  • T to C, chromosome 12 at 100,575,705 bp
  • A to G, chromosome 12 at 110,665,959 bp
  • C to T, chromosome 13 at 21,142,167 bp
  • G to A, chromosome 13 at 22,883,468 bp
  • A to T, chromosome 14 at 45,601,650 bp
  • A to G, chromosome 15 at 59,338,908 bp
  • A to G, chromosome 15 at 80,534,598 bp
  • A to C, chromosome 15 at 85,903,974 bp
  • A to C, chromosome 16 at 19,515,625 bp
  • G to A, chromosome 16 at 35,856,760 bp
  • T to A, chromosome 16 at 65,839,573 bp
  • T to A, chromosome 17 at 20,356,685 bp
  • T to A, chromosome 17 at 37,300,265 bp
  • A to T, chromosome 17 at 52,893,960 bp
  • G to T, chromosome 17 at 52,893,961 bp
  • C to T, chromosome 18 at 10,768,149 bp
  • A to T, chromosome 18 at 76,876,132 bp
  • A to G, chromosome 19 at 3,935,228 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1237 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039304-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.