Strain Detail Sheet
- T to A, chromosome 1 at 156,858,584 bp
- A to T, chromosome 2 at 66,680,295 bp
- A to G, chromosome 2 at 79,279,146 bp
- A to G, chromosome 2 at 80,293,176 bp
- C to T, chromosome 3 at 97,582,731 bp
- T to A, chromosome 4 at 21,730,457 bp
- A to G, chromosome 4 at 126,180,069 bp
- T to C, chromosome 5 at 104,948,357 bp
- C to T, chromosome 5 at 121,321,507 bp
- A to T, chromosome 5 at 140,741,284 bp
- C to T, chromosome 6 at 91,890,787 bp
- C to T, chromosome 6 at 118,612,625 bp
- T to C, chromosome 6 at 133,055,208 bp
- A to T, chromosome 8 at 45,044,279 bp
- T to C, chromosome 9 at 85,720,748 bp
- GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
- A to C, chromosome 10 at 61,303,649 bp
- T to A, chromosome 10 at 130,387,856 bp
- C to T, chromosome 11 at 32,516,125 bp
- A to G, chromosome 11 at 53,979,772 bp
- T to C, chromosome 11 at 77,474,574 bp
- T to C, chromosome 12 at 100,575,705 bp
- A to G, chromosome 12 at 110,665,959 bp
- C to T, chromosome 13 at 21,142,167 bp
- G to A, chromosome 13 at 22,883,468 bp
- A to T, chromosome 14 at 45,601,650 bp
- A to G, chromosome 15 at 59,338,908 bp
- A to G, chromosome 15 at 80,534,598 bp
- A to C, chromosome 15 at 85,903,974 bp
- A to C, chromosome 16 at 19,515,625 bp
- G to A, chromosome 16 at 35,856,760 bp
- T to A, chromosome 16 at 65,839,573 bp
- T to A, chromosome 17 at 20,356,685 bp
- T to A, chromosome 17 at 37,300,265 bp
- A to T, chromosome 17 at 52,893,960 bp
- G to T, chromosome 17 at 52,893,961 bp
- C to T, chromosome 18 at 10,768,149 bp
- A to T, chromosome 18 at 76,876,132 bp
- A to G, chromosome 19 at 3,935,228 bp
- Genotyping Protocol(s)
- Center protocol and contact for technical support will be shipped with mice.
Colony Surveillance Program and Current Health Reports
Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
| MMRRC Item # | Description | Distribution Fee / Unit (US $) *Shipping & Handling not included* |
Units | Notes |
|---|---|---|---|---|
| 039304-MU-RESUS | Litter recovered from cryo-archive | $5,475.00 / Non-Profit | Litter | Recovered litter4; additional fees for any special requests. |
| Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information. | ||||
Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.