Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1239Btlr/Mmmh
Stock Number:
039306-MU
Citation ID:
RRID:MMRRC_039306-MU
Other Names:
R1239 (G1), C57BL/6J-MtgxR1239Btlr
Major Collection:

Strain Information

Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Mgmt
Name: O-6-methylguanine-DNA methyltransferase
Synonyms: AGT, Agat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17314
HGNC: HGNC:7059
Homologene: 31089
Rbm5
Name: RNA binding motif protein 5
Synonyms: D030069N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83486
HGNC: HGNC:9902
Homologene: 21177
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Plcg2
Name: phospholipase C, gamma 2
Synonyms: Plcg-2, PLCgamma2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234779
HGNC: HGNC:9066
Homologene: 55671
Cpsf6
Name: cleavage and polyadenylation specific factor 6
Synonyms: HPBRII-7, HPBRII-4, CFIM68, 4733401N12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432508
Homologene: 134126
Hk2
Name: hexokinase 2
Synonyms: HKII
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15277
HGNC: HGNC:4923
Homologene: 37273
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Podxl2
Name: podocalyxin-like 2
Synonyms: PODLX2, D130074J02Rik, Endoglycan
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319655
Homologene: 9254
Chd1l
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: Snf2p, 4432404A22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68058
HGNC: HGNC:1916
Homologene: 11590
Dnajc6
Name: DnaJ heat shock protein family (Hsp40) member C6
Synonyms: 2810027M23Rik, auxilin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72685
Homologene: 8865
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Ermap
Name: erythroblast membrane-associated protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27028
Homologene: 22782
Cyp1a2
Name: cytochrome P450, family 1, subfamily a, polypeptide 2
Synonyms: P450-3, CP12, aromatic compound inducible
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13077
VEGA: 9
HGNC: HGNC:2596
Homologene: 68082
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
E230025N22Rik
Name: Riken cDNA E230025N22 gene
Synonyms: EG240216
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240216
Homologene: 131194
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Rap1gap
Name: Rap1 GTPase-activating protein
Synonyms: 2310004O14Rik, 1300019I11Rik, Rap1ga1, Gap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110351
HGNC: HGNC:9858
Homologene: 2163
Actn3
Name: actinin alpha 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11474
HGNC: HGNC:165
Homologene: 862
Or2ad1
Name: olfactory receptor family 2 subfamily AD member 1
Synonyms: GA_x6K02T2QHY8-12104556-12105500, MOR256-15, Olfr1368
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258527
Homologene: 105156
Ces4a
Name: carboxylesterase 4A
Synonyms: Ces8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234677
Homologene: 71949
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Skida1
Name: SKI/DACH domain containing 1
Synonyms: 5730507N06Rik, 2810030E01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72668
Homologene: 66327
H2-Bl
Name: histocompatibility 2, blastocyst
Synonyms: blastocyst MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14963
Homologene: 128352
Gstm2
Name: glutathione S-transferase, mu 2
Synonyms: Gstb-2, Gstb2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14863
Homologene: 121492
Zbtb39
Name: zinc finger and BTB domain containing 39
Synonyms: 7030401O21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320080
VEGA: 10
Homologene: 8890
Or5b109
Name: olfactory receptor family 5 subfamily B member 109
Synonyms: GA_x6K02T2RE5P-3560863-3561795, MOR202-29P, Olfr1463
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258120
HGNC: HGNC:8324
Homologene: 133886
Vmn1r16
Name: vomeronasal 1 receptor 16
Synonyms: V1rc29
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171202
Homologene: 123821
Jpt2
Name: Jupiter microtubule associated homolog 2
Synonyms: 2810430B18Rik, D17Ertd441e, Hn1l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52009
VEGA: 17
Homologene: 16934
Gatd3a
Name: glutamine amidotransferase like class 1 domain containing 3A
Synonyms: D10Jhu81e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28295
VEGA: 10
HGNC: HGNC:1273
Homologene: 3416
Phc3
Name: polyhomeotic 3
Synonyms: EDR3, HPH3, E030046K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241915
Homologene: 69390
Matcap2
Name: microtubule associated tyrosine carboxypeptidase 2
Synonyms: 9530077C05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68283
VEGA: 9
Homologene: 19280
Clba1
Name: clathrin binding box of aftiphilin containing 1
Synonyms: Flj20080, C130001I08Rik, BC022687
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217887
VEGA: 12
Homologene: 17077
Cplx2
Name: complexin 2
Synonyms: 921-L, Gm34843
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12890
HGNC: HGNC:2310
Homologene: 38212
Or5an11
Name: olfactory receptor family 5 subfamily AN member 11
Synonyms: GA_x6K02T2LL2P-1028-792, GA_x6K02T057QT-4025-4642, GA_x6K02T03CT6-1-477, MOR214-3, MOR214-3, Olfr245, Olfr232, Olfr235
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258681
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 2 at 18,047,317 bp
  • A to T, chromosome 2 at 120,533,594 bp
  • T to C, chromosome 2 at 150,191,971 bp
  • A to G, chromosome 3 at 30,914,130 bp
  • C to T, chromosome 3 at 97,582,731 bp
  • G to A, chromosome 3 at 107,984,028 bp
  • T to C, chromosome 4 at 63,318,915 bp
  • T to C, chromosome 4 at 101,635,116 bp
  • T to C, chromosome 4 at 119,188,925 bp
  • G to T, chromosome 4 at 137,717,996 bp
  • T to C, chromosome 5 at 90,288,676 bp
  • C to T, chromosome 6 at 57,323,633 bp
  • C to T, chromosome 6 at 82,749,308 bp
  • C to T, chromosome 6 at 88,849,983 bp
  • C to T, chromosome 6 at 118,612,625 bp
  • T to G, chromosome 6 at 122,081,678 bp
  • T to C, chromosome 7 at 137,128,057 bp
  • A to G, chromosome 8 at 23,096,155 bp
  • T to C, chromosome 8 at 105,149,498 bp
  • T to A, chromosome 8 at 117,556,044 bp
  • GTTCTTC to GTTC, chromosome 9 at 22,424,699 bp
  • A to G, chromosome 9 at 42,332,485 bp
  • A to G, chromosome 9 at 57,681,767 bp
  • GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
  • A to G, chromosome 9 at 107,752,966 bp
  • A to G, chromosome 10 at 78,168,927 bp
  • G to A, chromosome 10 at 117,361,343 bp
  • G to T, chromosome 10 at 127,743,069 bp
  • A to G, chromosome 12 at 112,809,503 bp
  • A to T, chromosome 13 at 11,883,043 bp
  • C to T, chromosome 13 at 21,142,167 bp
  • G to T, chromosome 13 at 54,379,602 bp
  • G to T, chromosome 15 at 64,716,062 bp
  • G to T, chromosome 15 at 85,979,146 bp
  • G to A, chromosome 16 at 35,856,760 bp
  • A to G, chromosome 16 at 73,024,542 bp
  • T to C, chromosome 17 at 24,960,611 bp
  • C to A, chromosome 17 at 36,083,512 bp
  • T to C, chromosome 18 at 36,685,475 bp
  • C to T, chromosome 19 at 4,865,455 bp
  • G to T, chromosome 19 at 12,268,976 bp
  • G to A, chromosome 19 at 13,234,676 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1239 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039306-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.