Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1240Btlr/Mmmh
Stock Number:
039307-MU
Citation ID:
RRID:MMRRC_039307-MU
Other Names:
R1240 (G1), C57BL/6J-MtgxR1240Btlr
Major Collection:

Strain Information

Mc1r
Name: melanocortin 1 receptor
Synonyms: e, Mshra, extension recessive yellow, Mcr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17199
HGNC: HGNC:6929
Homologene: 1789
H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Lgi1
Name: leucine-rich repeat LGI family, member 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56839
HGNC: HGNC:6572
Homologene: 3737
Kat2b
Name: K(lysine) acetyltransferase 2B
Synonyms: A930006P13Rik, Pcaf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18519
HGNC: HGNC:8638
Homologene: 20834
Cenpc1
Name: centromere protein C1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12617
HGNC: HGNC:1854
Homologene: 1371
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Dph6
Name: diphthamine biosynthesis 6
Synonyms: 5730421E18Rik, Diphthine ammonia ligase, Atpbd4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66632
Homologene: 80244
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 66,635,902 bp
  • T to C, chromosome 1 at 91,361,015 bp
  • A to G, chromosome 1 at 153,785,191 bp
  • A to T, chromosome 1 at 175,604,015 bp
  • T to A, chromosome 2 at 52,296,309 bp
  • T to G, chromosome 2 at 86,182,109 bp
  • T to G, chromosome 2 at 90,138,813 bp
  • A to T, chromosome 2 at 104,991,561 bp
  • T to C, chromosome 2 at 114,644,718 bp
  • A to G, chromosome 2 at 120,059,555 bp
  • T to A, chromosome 2 at 126,124,585 bp
  • A to T, chromosome 4 at 19,819,212 bp
  • T to C, chromosome 4 at 32,563,198 bp
  • C to T, chromosome 4 at 33,174,859 bp
  • A to G, chromosome 4 at 94,692,937 bp
  • A to T, chromosome 4 at 113,717,107 bp
  • T to C, chromosome 4 at 133,486,504 bp
  • T to C, chromosome 4 at 138,229,698 bp
  • T to A, chromosome 4 at 139,476,128 bp
  • T to C, chromosome 5 at 52,660,679 bp
  • G to T, chromosome 5 at 86,035,510 bp
  • T to C, chromosome 5 at 122,404,179 bp
  • T to G, chromosome 5 at 124,089,921 bp
  • T to G, chromosome 5 at 145,774,440 bp
  • T to A, chromosome 6 at 42,268,945 bp
  • T to C, chromosome 6 at 48,905,615 bp
  • T to A, chromosome 6 at 87,349,116 bp
  • C to T, chromosome 6 at 89,321,050 bp
  • T to A, chromosome 6 at 123,851,905 bp
  • C to A, chromosome 6 at 125,603,308 bp
  • A to G, chromosome 7 at 28,120,525 bp
  • T to C, chromosome 7 at 121,156,490 bp
  • A to G, chromosome 8 at 48,287,893 bp
  • A to C, chromosome 8 at 80,788,530 bp
  • T to A, chromosome 8 at 123,408,260 bp
  • T to C, chromosome 9 at 95,405,483 bp
  • G to T, chromosome 9 at 99,584,020 bp
  • A to G, chromosome 9 at 110,627,108 bp
  • A to C, chromosome 10 at 27,041,124 bp
  • T to C, chromosome 10 at 30,590,825 bp
  • G to T, chromosome 11 at 70,096,850 bp
  • A to G, chromosome 11 at 71,113,466 bp
  • A to T, chromosome 11 at 84,023,356 bp
  • A to G, chromosome 11 at 89,392,134 bp
  • T to C, chromosome 11 at 90,002,814 bp
  • C to A, chromosome 11 at 115,880,501 bp
  • G to T, chromosome 12 at 35,091,406 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • C to A, chromosome 12 at 55,844,508 bp
  • G to A, chromosome 12 at 112,610,776 bp
  • C to T, chromosome 13 at 97,929,492 bp
  • A to T, chromosome 14 at 18,211,891 bp
  • T to A, chromosome 15 at 13,057,455 bp
  • G to A, chromosome 15 at 57,250,872 bp
  • T to A, chromosome 15 at 66,828,548 bp
  • T to C, chromosome 15 at 75,670,067 bp
  • T to C, chromosome 16 at 14,146,762 bp
  • A to G, chromosome 16 at 35,698,009 bp
  • C to T, chromosome 16 at 97,837,600 bp
  • G to T, chromosome 17 at 34,138,406 bp
  • A to G, chromosome 17 at 53,624,397 bp
  • G to T, chromosome 17 at 64,309,618 bp
  • C to T, chromosome 18 at 15,453,174 bp
  • A to G, chromosome 19 at 4,290,679 bp
  • A to G, chromosome 19 at 38,284,051 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1240 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039307-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.