Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1276Btlr/Mmmh
Stock Number:
039342-MU
Citation ID:
RRID:MMRRC_039342-MU
Other Names:
R1276 (G1), C57BL/6J-MtgxR1276Btlr
Major Collection:

Strain Information

Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Egln2
Name: egl-9 family hypoxia-inducible factor 2
Synonyms: SM-20, Ier4, 0610011A13Rik, Phd1, Hif-p4h-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 112406
Homologene: 14204
Wasf1
Name: WASP family, member 1
Synonyms: WAVE-1, Scar, WAVE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83767
Homologene: 2920
Cox4i1
Name: cytochrome c oxidase subunit 4I1
Synonyms: Cox4, Cox4a, COXIV
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12857
HGNC: HGNC:2265
Homologene: 37537
Stau1
Name: staufen double-stranded RNA binding protein 1
Synonyms: 5830401L18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20853
Homologene: 3384
Hdlbp
Name: high density lipoprotein (HDL) binding protein
Synonyms: D1Ertd101e, 1110005P14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110611
HGNC: HGNC:4857
Homologene: 38035
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Rcbtb1
Name: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms: 5430409I18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71330
Homologene: 10061
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Itpr-1, Ip3r, Pcp-1, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Cct4
Name: chaperonin containing TCP1 subunit 4
Synonyms: A45, TCP-1 delta, T complex protein 1, delta, Cctd, 2610204B21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12464
HGNC: HGNC:1617
Homologene: 4695
Ddx47
Name: DEAD box helicase 47
Synonyms: 4930588A18Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67755
Homologene: 6092
Wipi2
Name: WD repeat domain, phosphoinositide interacting 2
Synonyms: 1110018O08Rik, 2510001I10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74781
Homologene: 90887
Srsf4
Name: serine and arginine-rich splicing factor 4
Synonyms: MNCb-2616, 5730499P16Rik, SRp75, Sfrs4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 57317
Homologene: 25624
Cep63
Name: centrosomal protein 63
Synonyms: CD20R, ET2, D9Mgc41, D9Mgc48e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 28135
Homologene: 11861
Gm9847
Name: predicted pseudogene 9847
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100043256
VEGA: 12
Ska3
Name: spindle and kinetochore associated complex subunit 3
Synonyms: F630043A04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219114
VEGA: 14
Homologene: 124284
Slc11a2
Name: solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
Synonyms: DMT1, DCT1, van, Nramp2, microcytic anemia, viable anaemia
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18174
Homologene: 55471
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Wdr24
Name: WD repeat domain 24
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268933
Homologene: 6870
Dcdc5
Name: doublecortin domain containing 5
Synonyms: 4732421G10Rik, EG436559
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329482
Homologene: 79722
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Zfp654
Name: zinc finger protein 654
Synonyms: 1600021C16Rik, 1810008K20Rik, Gm5488
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72020
Homologene: 10114
Sh3pxd2a
Name: SH3 and PX domains 2A
Synonyms: Fish, Sh3md1, Tks5, 2310014D11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14218
VEGA: 19
Homologene: 7317
Vmn1r194
Name: vomeronasal 1 receptor 194
Synonyms: Gm11294
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 626299
Homologene: 110880
Chd5
Name: chromodomain helicase DNA binding protein 5
Synonyms: B230399N07Rik, 4930532L22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269610
Homologene: 56712
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94229
Homologene: 23340
Zbtb4
Name: zinc finger and BTB domain containing 4
Synonyms: 2310026P19Rik, 9230111I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75580
Homologene: 10846
Thsd7a
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330267
Homologene: 46582
Tbc1d9b
Name: TBC1 domain family, member 9B
Synonyms: 2700008N14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76795
Homologene: 28106
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Tcf21
Name: transcription factor 21
Synonyms: epc, epicardin, capsulin, Pod1, Pod-1, podocyte-expressed 1, bHLHa23
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21412
VEGA: 10
Homologene: 2414
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Zkscan7
Name: zinc finger with KRAB and SCAN domains 7
Synonyms: Zfp167
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382118
VEGA: 9
Homologene: 83284
Fbxw15
Name: F-box and WD-40 domain protein 15
Synonyms: Fbxo12J
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382105
Homologene: 110776
Cyp2c69
Name: cytochrome P450, family 2, subfamily c, polypeptide 69
Synonyms: AI098658
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100043108
VEGA: 19
Homologene: 74936
Adgra2
Name: adhesion G protein-coupled receptor A2
Synonyms: Tem5, 9530074E10Rik, 8430414O08Rik, Gpr124
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78560
Homologene: 13112
Semg1
Name: semenogelin 1
Synonyms: semenoclotin, SVS II, Svs2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53878
Homologene: 49325
Ccdc82
Name: coiled-coil domain containing 82
Synonyms: 2310043N13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66396
VEGA: 9
Homologene: 11678
Mydgf
Name: myeloid derived growth factor
Synonyms: D17Wsu104e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 28106
Homologene: 10425
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 93,421,101 bp
  • A to T, chromosome 1 at 161,857,456 bp
  • A to T, chromosome 2 at 41,728,576 bp
  • A to G, chromosome 2 at 62,250,443 bp
  • A to G, chromosome 2 at 106,362,098 bp
  • T to A, chromosome 2 at 164,237,248 bp
  • A to C, chromosome 2 at 166,960,135 bp
  • T to A, chromosome 3 at 86,664,526 bp
  • C to T, chromosome 4 at 131,897,685 bp
  • T to A, chromosome 4 at 152,378,734 bp
  • T to C, chromosome 5 at 142,659,631 bp
  • C to A, chromosome 6 at 12,418,370 bp
  • A to G, chromosome 6 at 108,381,373 bp
  • T to C, chromosome 6 at 135,020,692 bp
  • TTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTG, chromosome 7 at 27,165,005 bp
  • C to A, chromosome 8 at 27,119,824 bp
  • A to G, chromosome 8 at 120,673,350 bp
  • A to T, chromosome 9 at 13,281,413 bp
  • A to T, chromosome 9 at 102,588,900 bp
  • G to A, chromosome 9 at 109,558,246 bp
  • A to G, chromosome 9 at 122,890,723 bp
  • G to A, chromosome 10 at 22,819,590 bp
  • T to A, chromosome 10 at 40,936,526 bp
  • C to T, chromosome 11 at 23,002,171 bp
  • T to A, chromosome 11 at 50,152,649 bp
  • G to T, chromosome 11 at 69,776,219 bp
  • A to G, chromosome 12 at 14,494,931 bp
  • A to G, chromosome 12 at 75,941,189 bp
  • A to G, chromosome 13 at 22,244,861 bp
  • T to C, chromosome 14 at 12,220,577 bp
  • T to C, chromosome 14 at 57,820,269 bp
  • T to C, chromosome 14 at 59,210,427 bp
  • T to C, chromosome 15 at 6,779,273 bp
  • A to G, chromosome 15 at 85,229,590 bp
  • A to G, chromosome 15 at 100,395,331 bp
  • A to T, chromosome 16 at 64,785,336 bp
  • T to C, chromosome 17 at 18,257,082 bp
  • A to G, chromosome 17 at 25,827,467 bp
  • A to G, chromosome 17 at 56,179,362 bp
  • T to C, chromosome 18 at 61,165,504 bp
  • T to A, chromosome 19 at 39,876,224 bp
  • T to C, chromosome 19 at 47,268,383 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1276 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039342-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.