Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1283Btlr/Mmmh
Stock Number:
039349-MU
Citation ID:
RRID:MMRRC_039349-MU
Other Names:
R1283 (G1), C57BL/6J-MtgxR1283Btlr
Major Collection:

Strain Information

Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Faf1
Name: Fas-associated factor 1
Synonyms: Fam, Dffrx
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14084
HGNC: HGNC:3578
Homologene: 5120
Rab11fip3
Name: RAB11 family interacting protein 3 (class II)
Synonyms: Rab11-FIP3, D030060O14Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 215445
Homologene: 49396
Lamb2
Name: laminin, beta 2
Synonyms: Lamb-2, Lams, npht
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Mgst3
Name: microsomal glutathione S-transferase 3
Synonyms: GST-III, 2010306B17Rik, 2010012L10Rik, 2700004G04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66447
HGNC: HGNC:7064
Homologene: 3327
Mfsd12
Name: major facilitator superfamily domain containing 12
Synonyms: Wdt1, F630110N24Rik, gr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73822
Homologene: 45488
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Ap4b1
Name: adaptor-related protein complex AP-4, beta 1
Synonyms: AP-4 beta-4, 1810038H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67489
HGNC: HGNC:572
Homologene: 38203
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Abca2
Name: ATP-binding cassette, sub-family A member 2
Synonyms: Abc2, D2H0S1474E
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11305
HGNC: HGNC:32
Homologene: 55590
Gins3
Name: GINS complex subunit 3
Synonyms: 2700085M18Rik, Psf3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78833
Homologene: 41496
Fbxw15
Name: F-box and WD-40 domain protein 15
Synonyms: Fbxo12J
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382105
Homologene: 110776
Trpt1
Name: tRNA phosphotransferase 1
Synonyms: TPT1, EST-MNCb3719, Tpt1h
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107328
VEGA: 19
Homologene: 12878
Fdxacb1
Name: ferredoxin-fold anticodon binding domain containing 1
Synonyms: D630004A14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382137
Homologene: 19813
Or52n20
Name: olfactory receptor family 52 subfamily N member 20
Synonyms: GA_x6K02T2PBJ9-7298889-7299857, MOR34-4, Olfr659
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259052
Homologene: 74118
Slc25a44
Name: solute carrier family 25, member 44
Synonyms: B430110G05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229517
Homologene: 14000
Tmem170b
Name: transmembrane protein 170B
Synonyms: EG621976
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 621976
VEGA: 13
Homologene: 73249
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 167,378,296 bp
  • T to A, chromosome 2 at 25,446,689 bp
  • T to C, chromosome 3 at 88,420,578 bp
  • T to A, chromosome 3 at 103,818,861 bp
  • T to C, chromosome 4 at 109,935,705 bp
  • A to G, chromosome 7 at 104,670,943 bp
  • A to G, chromosome 8 at 95,637,946 bp
  • A to G, chromosome 9 at 50,768,694 bp
  • A to G, chromosome 9 at 108,481,808 bp
  • G to A, chromosome 9 at 109,558,246 bp
  • T to C, chromosome 10 at 81,361,435 bp
  • A to T, chromosome 11 at 67,370,921 bp
  • A to G, chromosome 13 at 23,478,832 bp
  • T to C, chromosome 13 at 41,627,995 bp
  • T to C, chromosome 15 at 63,825,057 bp
  • T to C, chromosome 15 at 100,969,171 bp
  • TACCACCACCACCACCACCACCACCA to TACCACCACCACCACCACCACCA, chromosome 16 at 56,257,939 bp
  • G to T, chromosome 17 at 26,004,554 bp
  • T to A, chromosome 19 at 6,998,328 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1283 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039349-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.