Strain Name:
C57BL/6J-MtgxR1306Btlr/Mmmh
Stock Number:
039372-MU
Citation ID:
RRID:MMRRC_039372-MU
Other Names:
R1306 (G1), C57BL/6J-MtgxR1306Btlr
Major Collection:

Gene Information

Pkd1
Name: polycystin 1, transient receptor poteintial channel interacting
Synonyms: PC-1, polycystin-1, PC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Gjd2
Name: gap junction protein, delta 2
Synonyms: connexin36, Gja9, Cx36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14617
Homologene: 7734
Mcm7
Name: minichromosome maintenance complex component 7
Synonyms: mCDC47, Mcmd7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 17220
HGNC: HGNC:6950
Homologene: 4323
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 71972
Homologene: 9061
Gabbr1
Name: gamma-aminobutyric acid (GABA) B receptor, 1
Synonyms: GABAB1, GABAbR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Bend5
Name: BEN domain containing 5
Synonyms: 2310026E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 67621
Homologene: 41574
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: 1110014E10Rik, D530031C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 320817
VEGA: 12
Homologene: 86351
Fat3
Name: FAT atypical cadherin 3
Synonyms: D430038H04Rik, LOC234973, 9430076A06Rik, LOC382129
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 270120
VEGA: 9
Homologene: 82252
Dpysl3
Name: dihydropyrimidinase-like 3
Synonyms: Ulip1, Ulip, CRMP-4, TUC4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 22240
HGNC: HGNC:3015
Homologene: 20361
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Pdzph1
Name: PDZ and pleckstrin homology domains 1
Synonyms: 2610034M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 69239
Homologene: 130756
Nckap1l
Name: NCK associated protein 1 like
Synonyms: Hem1, 4930568P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 105855
VEGA: 15
HGNC: HGNC:4862
Homologene: 3901
Ccser1
Name: coiled-coil serine rich 1
Synonyms: Fam190a, 6230405M12Rik, C130092O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232035
Homologene: 28086
Vwa3a
Name: von Willebrand factor A domain containing 3A
Synonyms: E030013G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233813
Homologene: 18607
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 116904
Homologene: 10813
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 329015
Homologene: 86985
Dennd4b
Name: DENN/MADD domain containing 4B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229541
Homologene: 28281
Pnmal1
Name: PNMA-like 1
Synonyms: 0710005I19Rik, 4930488B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 71691
Homologene: 10073
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, Plcl4, A930027K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 269615
Homologene: 85172
Ntn4
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 57764
Homologene: 10934
Smarca2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms: Snf2l2, 2610209L14Rik, brm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 67155
Homologene: 2308
Fmn1
Name: formin 1
Synonyms: Fmn, formin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Slc19a3
Name: solute carrier family 19, member 3
Synonyms: A230084E24Rik, ThTr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 80721
Homologene: 23530
Dok3
Name: docking protein 3
Synonyms: p62Dok-like protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 27261
VEGA: 13
Homologene: 8448
Sertad2
Name: SERTA domain containing 2
Synonyms: SEI-2, Trip-Br2, Sei2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 58172
Homologene: 8843
Meox2
Name: mesenchyme homeobox 2
Synonyms: Mox2, Mox-2, Gax
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 17286
HGNC: HGNC:7014
Homologene: 4330
Tm4sf19
Name: transmembrane 4 L six family member 19
Synonyms: EG277203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 277203
Homologene: 64632
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 83,022,762 bp
  • T to A, chromosome 2 at 113,525,139 bp
  • T to C, chromosome 2 at 114,011,865 bp
  • A to G, chromosome 3 at 90,271,165 bp
  • C to T, chromosome 4 at 111,459,773 bp
  • T to C, chromosome 4 at 155,007,140 bp
  • C to A, chromosome 5 at 138,167,203 bp
  • G to A, chromosome 6 at 62,380,106 bp
  • A to G, chromosome 6 at 139,772,428 bp
  • A to G, chromosome 7 at 16,962,025 bp
  • T to A, chromosome 7 at 81,093,873 bp
  • C to G, chromosome 7 at 120,800,390 bp
  • A to G, chromosome 9 at 16,376,679 bp
  • C to T, chromosome 10 at 93,707,353 bp
  • T to C, chromosome 11 at 20,648,388 bp
  • A to G, chromosome 12 at 4,974,239 bp
  • GCACCACCACCACCACCACCA to GCACCACCACCACCACCA, chromosome 12 at 37,109,031 bp
  • C to A, chromosome 13 at 55,527,448 bp
  • C to A, chromosome 15 at 103,478,860 bp
  • G to A, chromosome 16 at 32,407,902 bp
  • T to C, chromosome 17 at 24,573,172 bp
  • T to A, chromosome 17 at 37,055,990 bp
  • T to C, chromosome 17 at 58,932,432 bp
  • T to C, chromosome 18 at 43,363,500 bp
  • A to T, chromosome 19 at 6,253,021 bp
  • A to G, chromosome 19 at 26,770,988 bp
  • A to T, chromosome 19 at 43,901,779 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1306 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039372-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.