Strain Name:
C57BL/6J-MtgxR1377Btlr/Mmmh
Stock Number:
039441-MU
Citation ID:
RRID:MMRRC_039441-MU
Other Names:
R1377 (G1), C57BL/6J-MtgxR1377Btlr
Major Collection:

Strain Information

Arc
Name: activity regulated cytoskeletal-associated protein
Synonyms: arg 3.1, Arc3.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11838
HGNC: HGNC:648
Homologene: 9056
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: RPTPkappa, PTPk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: p53BP1, 53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Cep290
Name: centrosomal protein 290
Synonyms: Kiaa, b2b1454Clo, b2b1752Clo, Nphp6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Cry1
Name: cryptochrome circadian regulator 1
Synonyms: Phll1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12952
VEGA: 10
HGNC: HGNC:2384
Homologene: 7042
Wdr33
Name: WD repeat domain 33
Synonyms: WDC146, 2310011G05Rik, 8430413N20Rik, 2810021O11Rik, 1110001N06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74320
VEGA: 18
Homologene: 56807
Rbm15
Name: RNA binding motif protein 15
Synonyms: C230088J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229700
Homologene: 23383
Ccng1
Name: cyclin G1
Synonyms: cyclin G
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12450
HGNC: HGNC:1592
Homologene: 2995
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, Dnahc8, P1-Loop
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Fbxo46
Name: F-box protein 46
Synonyms: Fbxo34l, 20D7-FC4, 4932704E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243867
Homologene: 18467
Slc38a6
Name: solute carrier family 38, member 6
Synonyms: EG625098
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 625098
Homologene: 27550
Atp7b
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: WND, Wilson protein, Atp7a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11979
HGNC: HGNC:870
Homologene: 20063
Dscam
Name: DS cell adhesion molecule
Synonyms: Down syndrome cell adhesion molecule, 4932410A21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Zfp804a
Name: zinc finger protein 804A
Synonyms: C630007C17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241514
Homologene: 18461
Itgal
Name: integrin alpha L
Synonyms: Ly-15, LFA-1, Ly-21, Cd11a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16408
HGNC: HGNC:6148
Homologene: 1666
Zxdc
Name: ZXD family zinc finger C
Synonyms: B930086F11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 80292
Homologene: 82340
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR-A, Glur-1, Glur1, 2900051M01Rik, GluA1, Glr1, GluR1, HIPA1, Glr-1, GluRA
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Zfp454
Name: zinc finger protein 454
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237758
Homologene: 72226
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244668
Homologene: 18956
Has2
Name: hyaluronan synthase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15117
HGNC: HGNC:4819
Homologene: 3892
Nexn
Name: nexilin
Synonyms: 1110046H09Rik, nF actin binding protein
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68810
Homologene: 44892
Exoc3l4
Name: exocyst complex component 3-like 4
Synonyms: 1600013K19Rik, 1200009I06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74190
VEGA: 12
Homologene: 41760
Trhr2
Name: thyrotropin releasing hormone receptor 2
Synonyms: TRH-R2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170732
Homologene: 44052
Stoml3
Name: stomatin (Epb7.2)-like 3
Synonyms: SLP3, SRO
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229277
Homologene: 16628
Gm17661
Name: predicted gene, 17661
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 2 at 82,258,497 bp
  • GA to GAA, chromosome 2 at 90,917,709 bp
  • A to G, chromosome 2 at 121,270,642 bp
  • G to A, chromosome 3 at 53,507,641 bp
  • T to C, chromosome 3 at 107,330,758 bp
  • C to T, chromosome 3 at 152,237,650 bp
  • T to C, chromosome 6 at 90,378,903 bp
  • T to A, chromosome 7 at 19,136,425 bp
  • T to A, chromosome 7 at 127,321,917 bp
  • G to A, chromosome 8 at 22,011,785 bp
  • C to T, chromosome 8 at 122,360,588 bp
  • T to C, chromosome 8 at 125,491,977 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • G to A, chromosome 10 at 28,586,026 bp
  • A to G, chromosome 10 at 85,146,668 bp
  • T to A, chromosome 10 at 100,538,921 bp
  • G to A, chromosome 11 at 40,752,114 bp
  • T to C, chromosome 11 at 50,873,780 bp
  • C to A, chromosome 11 at 57,201,176 bp
  • T to A, chromosome 12 at 73,350,571 bp
  • A to T, chromosome 12 at 111,428,670 bp
  • T to C, chromosome 15 at 56,681,806 bp
  • G to A, chromosome 15 at 74,672,252 bp
  • A to G, chromosome 16 at 31,116,051 bp
  • A to G, chromosome 16 at 96,772,494 bp
  • A to T, chromosome 17 at 30,840,622 bp
  • T to A, chromosome 18 at 31,888,641 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1377 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039441-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.