Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1390Btlr/Mmmh
Stock Number:
039452-MU
Citation ID:
RRID:MMRRC_039452-MU
Other Names:
R1390 (G1), C57BL/6J-MtgxR1390Btlr
Major Collection:

Strain Information

Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Mcmbp
Name: minichromosome maintenance complex binding protein
Synonyms: 1110007A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210711
Homologene: 11749
Dido1
Name: death inducer-obliterator 1
Synonyms: DIO-1, 6720461J16Rik, D130048F08Rik, Datf1, dido, C130092D22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23856
HGNC: HGNC:2680
Homologene: 34139
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Ints8
Name: integrator complex subunit 8
Synonyms: D130008D20Rik, 2810013E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72656
Homologene: 9888
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, Cd, ska26, skax26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Zfp719
Name: zinc finger protein 719
Synonyms: C630016O21Rik, mszf6, 9430094P17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210105
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Strip2
Name: striatin interacting protein 2
Synonyms: Myoscape, D330017J20Rik, Fam40b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320609
Homologene: 66198
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4, m9Bei
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 59035
Homologene: 10990
Trerf1
Name: transcriptional regulating factor 1
Synonyms: Trep132, Trep-132, 9430096I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224829
Homologene: 14129
Galnt3
Name: polypeptide N-acetylgalactosaminyltransferase 3
Synonyms: ppGaNTase-T3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14425
HGNC: HGNC:4125
Homologene: 55827
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Adcy2
Name: adenylate cyclase 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210044
VEGA: 13
HGNC: HGNC:233
Homologene: 75133
Frem3
Name: Fras1 related extracellular matrix protein 3
Synonyms: LOC333315
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333315
Homologene: 35388
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Slco1b2
Name: solute carrier organic anion transporter family, member 1b2
Synonyms: mlst-1, Slc21a6, Slc21a10, Oatp1b2, 7330442B20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28253
Homologene: 75119
Vmn1r173
Name: vomeronasal 1 receptor 173
Synonyms: Gm5892
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545934
Homologene: 79577
Lnpk
Name: lunapark, ER junction formation factor
Synonyms: 2310011O18Rik, 4921514L11Rik, 9530051D01Rik, lunapark, Lnpk1, Lnp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69605
Homologene: 12319
Osbpl3
Name: oxysterol binding protein-like 3
Synonyms: OSBP3, ORP3, 1200014M06Rik, 6720421I08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71720
Homologene: 49422
Nid1
Name: nidogen 1
Synonyms: entactin, entactin 1, nidogen-1, entactin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Sorcs3
Name: sortilin-related VPS10 domain containing receptor 3
Synonyms: 6330404A12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66673
VEGA: 19
Homologene: 8986
Trim30d
Name: tripartite motif-containing 30D
Synonyms: TRIM30-3, Trim79
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 209387
Homologene: 114426
Casd1
Name: CAS1 domain containing 1
Synonyms: Cast1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213819
Homologene: 11287
Or4f47
Name: olfactory receptor family 4 subfamily F member 47
Synonyms: GA_x6K02T2Q125-73188162-73189112, MOR245-4, Olfr1317
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258440
Homologene: 71983
Zfp353-ps
Name: zinc finger protein 353, pseudogene
Synonyms: Zfp353
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234203
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 2 at 66,091,223 bp
  • A to G, chromosome 2 at 74,529,806 bp
  • A to G, chromosome 2 at 112,142,607 bp
  • A to G, chromosome 2 at 180,685,124 bp
  • A to T, chromosome 4 at 11,239,461 bp
  • A to T, chromosome 4 at 58,812,633 bp
  • A to G, chromosome 4 at 113,655,684 bp
  • G to A, chromosome 5 at 48,217,490 bp
  • T to C, chromosome 6 at 4,641,859 bp
  • G to T, chromosome 6 at 29,929,829 bp
  • T to A, chromosome 6 at 50,308,427 bp
  • A to G, chromosome 6 at 134,511,301 bp
  • A to T, chromosome 6 at 141,663,827 bp
  • T to G, chromosome 7 at 23,702,898 bp
  • A to G, chromosome 7 at 43,590,443 bp
  • G to T, chromosome 7 at 44,357,038 bp
  • T to C, chromosome 7 at 104,483,403 bp
  • A to C, chromosome 7 at 128,724,141 bp
  • T to A, chromosome 8 at 42,081,821 bp
  • T to C, chromosome 8 at 80,690,773 bp
  • A to G, chromosome 9 at 21,494,489 bp
  • T to A, chromosome 9 at 21,579,493 bp
  • T to C, chromosome 9 at 60,876,439 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • T to C, chromosome 11 at 59,093,448 bp
  • T to G, chromosome 13 at 13,476,246 bp
  • T to A, chromosome 13 at 68,657,393 bp
  • A to G, chromosome 17 at 47,315,135 bp
  • G to A, chromosome 19 at 48,694,001 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1390 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039452-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.