Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1437Btlr/Mmmh
Stock Number:
039492-MU
Citation ID:
RRID:MMRRC_039492-MU
Other Names:
R1437 (G1), C57BL/6J-MtgxR1437Btlr
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Pou2f1
Name: POU domain, class 2, transcription factor 1
Synonyms: Oct-1C, Oct-1B, Oct-1A, oct-1, Otf-1, Otf1, 2810482H01Rik, Oct-1z, Oct1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18986
HGNC: HGNC:9212
Homologene: 37658
Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Cdk4
Name: cyclin dependent kinase 4
Synonyms: p34PSK-J3/cdk4, Crk3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Plaat1
Name: phospholipase A and acyltransferase 1
Synonyms: A-C1, 2810012B06Rik, Hrasls
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27281
Homologene: 8452
Prepl
Name: prolyl endopeptidase-like
Synonyms: 9530014L06Rik, 2810457N15Rik, D030028O16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213760
VEGA: 17
Homologene: 15481
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,723,945 bp
  • G to T, chromosome 1 at 90,801,376 bp
  • T to C, chromosome 1 at 130,844,420 bp
  • A to G, chromosome 1 at 165,891,830 bp
  • CACTCAACACTAC to CAC, chromosome 1 at 171,217,141 bp
  • T to C, chromosome 2 at 28,468,887 bp
  • T to A, chromosome 2 at 38,710,673 bp
  • T to G, chromosome 2 at 59,878,133 bp
  • T to C, chromosome 2 at 85,414,874 bp
  • C to T, chromosome 2 at 87,149,771 bp
  • A to G, chromosome 2 at 121,138,896 bp
  • C to A, chromosome 3 at 36,942,429 bp
  • C to A, chromosome 3 at 63,697,533 bp
  • T to C, chromosome 3 at 72,934,142 bp
  • C to A, chromosome 3 at 125,561,450 bp
  • T to A, chromosome 4 at 53,561,006 bp
  • T to A, chromosome 4 at 100,412,109 bp
  • C to T, chromosome 4 at 141,167,854 bp
  • A to T, chromosome 4 at 149,158,109 bp
  • T to A, chromosome 5 at 8,821,436 bp
  • T to G, chromosome 5 at 84,233,696 bp
  • T to C, chromosome 5 at 87,001,031 bp
  • T to C, chromosome 5 at 105,481,702 bp
  • A to G, chromosome 5 at 117,351,570 bp
  • A to G, chromosome 5 at 150,310,425 bp
  • C to T, chromosome 6 at 3,517,852 bp
  • A to T, chromosome 6 at 30,624,655 bp
  • C to A, chromosome 6 at 136,840,092 bp
  • C to T, chromosome 7 at 30,753,053 bp
  • T to C, chromosome 7 at 33,278,555 bp
  • C to A, chromosome 7 at 35,213,170 bp
  • T to C, chromosome 7 at 43,979,690 bp
  • A to G, chromosome 7 at 44,860,402 bp
  • A to G, chromosome 7 at 46,179,813 bp
  • G to A, chromosome 7 at 80,382,399 bp
  • A to G, chromosome 8 at 70,844,551 bp
  • C to T, chromosome 8 at 110,581,985 bp
  • T to C, chromosome 9 at 21,192,592 bp
  • T to A, chromosome 9 at 65,372,055 bp
  • T to A, chromosome 9 at 115,254,927 bp
  • ACGCCGCCGCCGCCGCCGCCGCCGCCGCC to ACGCCGCCGCCGCCGCCGCCGCCGCC, chromosome 10 at 4,712,571 bp
  • T to C, chromosome 10 at 20,257,174 bp
  • T to C, chromosome 10 at 30,833,849 bp
  • A to G, chromosome 10 at 61,341,285 bp
  • A to G, chromosome 10 at 62,598,590 bp
  • G to A, chromosome 10 at 80,804,206 bp
  • A to G, chromosome 10 at 100,572,101 bp
  • C to A, chromosome 10 at 127,064,689 bp
  • A to G, chromosome 10 at 128,042,179 bp
  • C to T, chromosome 11 at 60,730,943 bp
  • C to A, chromosome 11 at 88,844,751 bp
  • T to C, chromosome 11 at 100,383,576 bp
  • T to A, chromosome 12 at 81,315,986 bp
  • T to A, chromosome 12 at 102,788,090 bp
  • T to C, chromosome 12 at 116,438,756 bp
  • A to G, chromosome 12 at 118,874,762 bp
  • T to C, chromosome 13 at 24,173,608 bp
  • T to A, chromosome 13 at 42,157,140 bp
  • G to T, chromosome 13 at 58,558,575 bp
  • C to T, chromosome 13 at 73,667,068 bp
  • T to C, chromosome 13 at 92,030,888 bp
  • C to G, chromosome 14 at 26,468,476 bp
  • T to C, chromosome 15 at 10,393,821 bp
  • A to T, chromosome 15 at 64,120,107 bp
  • G to T, chromosome 15 at 76,189,281 bp
  • T to C, chromosome 15 at 85,359,474 bp
  • C to A, chromosome 16 at 29,228,170 bp
  • T to G, chromosome 16 at 37,988,542 bp
  • T to G, chromosome 16 at 55,991,620 bp
  • A to G, chromosome 17 at 23,291,211 bp
  • T to A, chromosome 17 at 24,595,132 bp
  • A to G, chromosome 17 at 29,378,462 bp
  • T to C, chromosome 17 at 49,071,225 bp
  • G to A, chromosome 17 at 85,088,357 bp
  • G to C, chromosome 18 at 12,549,227 bp
  • A to T, chromosome 18 at 58,053,659 bp
  • G to T, chromosome 18 at 80,450,213 bp
  • C to A, chromosome 19 at 6,250,616 bp
  • A to T, chromosome 19 at 10,091,829 bp
  • A to G, chromosome 19 at 53,233,678 bp
  • G to T, chromosome 19 at 53,909,243 bp
  • T to G, chromosome 19 at 56,380,322 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1437 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039492-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.