Strain Name:
C57BL/6J-MtgxR1437Btlr/Mmmh
Stock Number:
039492-MU
Citation ID:
RRID:MMRRC_039492-MU
Other Names:
R1437 (G1), C57BL/6J-MtgxR1437Btlr
Major Collection:

Gene Information

Pkd1
Name: polycystin 1, transient receptor poteintial channel interacting
Synonyms: PC1, PC-1, polycystin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Pou2f1
Name: POU domain, class 2, transcription factor 1
Synonyms: Oct-1A, Otf1, Otf-1, Oct1, oct-1, 2810482H01Rik, Oct-1C, Oct-1z, Oct-1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18986
HGNC: HGNC:9212
Homologene: 37658
Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: X99384, paladin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 27355
VEGA: 10
Homologene: 8453
Cdk4
Name: cyclin-dependent kinase 4
Synonyms: Crk3, p34PSK-J3/cdk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 12567
HGNC: HGNC:1773
Homologene: 55429
Map7
Name: microtubule-associated protein 7
Synonyms: mste, mshi, Mtap7, E-MAP-115, ste
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Plaat1
Name: phospholipase A and acyltransferase 1
Synonyms: Hrasls, 2810012B06Rik, A-C1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 27281
Homologene: 8452
Prepl
Name: prolyl endopeptidase-like
Synonyms: 9530014L06Rik, D030028O16Rik, 2810457N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 213760
VEGA: 17
Homologene: 15481
Abcc8
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: Carmil, Lrrc16, Lrrc16a, 1110037D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 68732
Homologene: 9757
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1752Clo, Kiaa, b2b1454Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 216274
VEGA: 10
Homologene: 77213
Asap1
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Synonyms: Ddef1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 13196
HGNC: HGNC:2720
Homologene: 7684
Fry
Name: FRY microtubule binding protein
Synonyms: 9330186A19Rik, cg003
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 320365
Homologene: 113770
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: 5830426I05Rik, Luzp5, Mtb, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 76044
VEGA: 12
Homologene: 9820
Sf3a2
Name: splicing factor 3a, subunit 2
Synonyms: SFA66, Sap62, 66kDa, PRP11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 20222
Homologene: 133823
Fbxo42
Name: F-box protein 42
Synonyms: 6720460I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 213499
Homologene: 16234
Ctdp1
Name: CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Synonyms: 4930563P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 67655
HGNC: HGNC:2498
Homologene: 31254
Akap1
Name: A kinase (PRKA) anchor protein 1
Synonyms: S-AKAP84, DAKAP1, AKAP84, AKAP121
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 11640
HGNC: HGNC:367
Homologene: 31165
4932438A13Rik
Name: RIKEN cDNA 4932438A13 gene
Synonyms: FSA, Tweek
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229227
Homologene: 52105
Slc44a1
Name: solute carrier family 44, member 1
Synonyms: Cdw92, 2210409B22Rik, CTL1, CHTL1, 4833416H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100434
Homologene: 11137
Atxn10
Name: ataxin 10
Synonyms: TEG-169, E46, Tex169, Sca10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 54138
VEGA: 15
Homologene: 40858
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: Nr3a1, Estra, ERalpha, Estr, ER-alpha, ERa, ER[a], ESR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Pgd
Name: phosphogluconate dehydrogenase
Synonyms: 0610042A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 110208
HGNC: HGNC:8891
Homologene: 68268
Stt3b
Name: STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms: Simp, 1300006C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 68292
VEGA: 9
Homologene: 7387
Hey2
Name: hairy/enhancer-of-split related with YRPW motif 2
Synonyms: bHLHb32, Hesr2, Hrt2, CHF1, Herp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 15214
HGNC: HGNC:4881
Homologene: 22705
Nr5a1
Name: nuclear receptor subfamily 5, group A, member 1
Synonyms: Ftzf1, ELP, SF-1, Ftz-F1, SF1, Ad4BP, steroidogenic factor 1, adrenal 4-binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 26423
HGNC: HGNC:7983
Homologene: 3638
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 1700034M03Rik, Ccdc132, 8430415E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 73288
Homologene: 11498
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Plec
Name: plectin
Synonyms: Plec1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18810
HGNC: HGNC:9069
Homologene: 384
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Pnkp
Name: polynucleotide kinase 3'- phosphatase
Synonyms: 1810009G08Rik, PNK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 59047
HGNC: HGNC:9154
Homologene: 5247
Ror1
Name: receptor tyrosine kinase-like orphan receptor 1
Synonyms: Ntrkr1, 2810404D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 26563
Homologene: 3675
Add3
Name: adducin 3 (gamma)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 27360
VEGA: 19
HGNC: HGNC:245
Homologene: 40893
Jup
Name: junction plakoglobin
Synonyms: gamma-catenin, plakoglobin, PG, Ctnng, D930025P04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Ddx21
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 21
Synonyms: D10Ertd645e, D10Wsu42e, RH-II/Gualpha, RH II/Gu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 56200
VEGA: 10
HGNC: HGNC:2744
Homologene: 3473
Rpl24
Name: ribosomal protein L24
Synonyms: Bst, 0610008L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 68193
Homologene: 763
Slmap
Name: sarcolemma associated protein
Synonyms: Slap, D330001L02Rik, Miranda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 83997
Homologene: 31428
Sbsn
Name: suprabasin
Synonyms: 1110005D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 282619
Homologene: 17900
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: Dpde2, D9Ertd60e, dunce
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Lrp3
Name: low density lipoprotein receptor-related protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 435965
HGNC: HGNC:6695
Homologene: 1745
Fgd2
Name: FYVE, RhoGEF and PH domain containing 2
Synonyms: Tcd-2, Tcd2, tcs-2, tcs2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 26382
HGNC: HGNC:3664
Homologene: 8438
Epha5
Name: Eph receptor A5
Synonyms: Hek7, Rek7, Cek7, bsk, Els1, Ehk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: 4930545D19Rik, hy-3, hy3, 1700034M11Rik, hyrh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244653
Homologene: 52118
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 64580
Homologene: 11208
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Slc6a18
Name: solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms: XT2, Xtrp2, D630001K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 22598
VEGA: 13
Homologene: 40785
Sis
Name: sucrase isomaltase (alpha-glucosidase)
Synonyms: sucrase-isomaltase, 2010204N08Rik, Si-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 69983
Homologene: 37424
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Fbn2
Name: fibrillin 2
Synonyms: Sne, Fib-2, sy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Nr1i3
Name: nuclear receptor subfamily 1, group I, member 3
Synonyms: mCAR, Care2, CAR1, MB67, CAR, ESTM32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12355
HGNC: HGNC:7969
Homologene: 3759
Abcb1b
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 1B
Synonyms: Pgy-1, Mdr1, Abcb1, Mdr1b, mdr, Pgy1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 18669
Homologene: 69084
Slc8a3
Name: solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms: Ncx3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 110893
Homologene: 62645
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Abcb5
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms: 9230106F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 77706
HGNC: HGNC:46
Homologene: 83488
Mrps2
Name: mitochondrial ribosomal protein S2
Synonyms: 1500019M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 118451
Homologene: 99837
Arhgef4
Name: Rho guanine nucleotide exchange factor (GEF) 4
Synonyms: Asef, C230030N03Rik, 9330140K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 329015
Homologene: 86985
Vsig10
Name: V-set and immunoglobulin domain containing 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231668
Homologene: 10414
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 666002
Homologene: 86604
Fes
Name: feline sarcoma oncogene
Synonyms: c-fes
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 14159
HGNC: HGNC:3657
Homologene: 37563
Wdsub1
Name: WD repeat, SAM and U-box domain containing 1
Synonyms: 2610014F08Rik, 1700048E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 72137
Homologene: 17609
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Agxt2
Name: alanine-glyoxylate aminotransferase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 268782
Homologene: 12887
Klk1b9
Name: kallikrein 1-related peptidase b9
Synonyms: Egfbp3, Egfbp-3, mGk-9, Klk9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 13648
HGNC: HGNC:6364
Homologene: 68141
Mief2
Name: mitochondrial elongation factor 2
Synonyms: LOC237781, Smcr7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237781
Homologene: 27354
Slc28a3
Name: solute carrier family 28 (sodium-coupled nucleoside transporter), member 3
Synonyms: Cnt3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 114304
Homologene: 32533
Lrfn2
Name: leucine rich repeat and fibronectin type III domain containing 2
Synonyms: SALM1, 5730420O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 70530
Homologene: 19182
Ugt2b35
Name: UDP glucuronosyltransferase 2 family, polypeptide B35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243085
Homologene: 128251
BC049715
Name: cDNA sequence BC049715
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 320135
Homologene: 52193
Plch1
Name: phospholipase C, eta 1
Synonyms: Plcl3, PLCeta1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 269437
Homologene: 88833
Lcmt2
Name: leucine carboxyl methyltransferase 2
Synonyms: Tyw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 329504
Homologene: 19642
AC145553.3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
Olfr993
Name: olfactory receptor 993
Synonyms: MOR203-2, GA_x6K02T2Q125-46891524-46890580
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258427
Homologene: 79352
Rasgrf2
Name: RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms: Grf2, 6330417G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 19418
HGNC: HGNC:9876
Homologene: 2169
Lrrc8b
Name: leucine rich repeat containing 8 family, member B
Synonyms: 2210408K08Rik, R75581
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 433926
Homologene: 9103
Gpr156
Name: G protein-coupled receptor 156
Synonyms: Gababl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 239845
VEGA: 16
Homologene: 17683
Olfr1111
Name: olfactory receptor 1111
Synonyms: MOR181-2, GA_x6K02T2Q125-48635468-48634530
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258586
Homologene: 74238
Cpa5
Name: carboxypeptidase A5
Synonyms: 4930430M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 74649
Homologene: 62246
Pdcd4
Name: programmed cell death 4
Synonyms: TIS, MA-3, D19Ucla1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18569
VEGA: 19
HGNC: HGNC:8763
Homologene: 7879
Kcnn1
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Synonyms: SK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 84036
HGNC: HGNC:6290
Homologene: 37595
Btbd7
Name: BTB (POZ) domain containing 7
Synonyms: E130118E17Rik, 5730507E09Rik, FUP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238386
VEGA: 12
Homologene: 34300
Ubap1l
Name: ubiquitin-associated protein 1-like
Synonyms: LOC208080, Gm514
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 208080
VEGA: 9
Homologene: 19477
Fads2
Name: fatty acid desaturase 2
Synonyms: 2900042M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 56473
VEGA: 19
HGNC: HGNC:3575
Homologene: 3149
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,723,945 bp
  • G to T, chromosome 1 at 90,801,376 bp
  • T to C, chromosome 1 at 130,844,420 bp
  • A to G, chromosome 1 at 165,891,830 bp
  • CACTCAACACTAC to CAC, chromosome 1 at 171,217,141 bp
  • T to C, chromosome 2 at 28,468,887 bp
  • T to A, chromosome 2 at 38,710,673 bp
  • T to G, chromosome 2 at 59,878,133 bp
  • T to C, chromosome 2 at 85,414,874 bp
  • C to T, chromosome 2 at 87,149,771 bp
  • A to G, chromosome 2 at 121,138,896 bp
  • C to A, chromosome 3 at 36,942,429 bp
  • C to A, chromosome 3 at 63,697,533 bp
  • T to C, chromosome 3 at 72,934,142 bp
  • C to A, chromosome 3 at 125,561,450 bp
  • T to A, chromosome 4 at 53,561,006 bp
  • T to A, chromosome 4 at 100,412,109 bp
  • C to T, chromosome 4 at 141,167,854 bp
  • A to T, chromosome 4 at 149,158,109 bp
  • T to A, chromosome 5 at 8,821,436 bp
  • T to G, chromosome 5 at 84,233,696 bp
  • T to C, chromosome 5 at 87,001,031 bp
  • T to C, chromosome 5 at 105,481,702 bp
  • A to G, chromosome 5 at 117,351,570 bp
  • A to G, chromosome 5 at 150,310,425 bp
  • C to T, chromosome 6 at 3,517,852 bp
  • A to T, chromosome 6 at 30,624,655 bp
  • C to A, chromosome 6 at 136,840,092 bp
  • C to T, chromosome 7 at 30,753,053 bp
  • T to C, chromosome 7 at 33,278,555 bp
  • C to A, chromosome 7 at 35,213,170 bp
  • T to C, chromosome 7 at 43,979,690 bp
  • A to G, chromosome 7 at 44,860,402 bp
  • A to G, chromosome 7 at 46,179,813 bp
  • G to A, chromosome 7 at 80,382,399 bp
  • A to G, chromosome 8 at 70,844,551 bp
  • C to T, chromosome 8 at 110,581,985 bp
  • T to C, chromosome 9 at 21,192,592 bp
  • T to A, chromosome 9 at 65,372,055 bp
  • T to A, chromosome 9 at 115,254,927 bp
  • ACGCCGCCGCCGCCGCCGCCGCCGCCGCC to ACGCCGCCGCCGCCGCCGCCGCCGCC, chromosome 10 at 4,712,571 bp
  • T to C, chromosome 10 at 20,257,174 bp
  • T to C, chromosome 10 at 30,833,849 bp
  • A to G, chromosome 10 at 61,341,285 bp
  • A to G, chromosome 10 at 62,598,590 bp
  • G to A, chromosome 10 at 80,804,206 bp
  • A to G, chromosome 10 at 100,572,101 bp
  • C to A, chromosome 10 at 127,064,689 bp
  • A to G, chromosome 10 at 128,042,179 bp
  • C to T, chromosome 11 at 60,730,943 bp
  • C to A, chromosome 11 at 88,844,751 bp
  • T to C, chromosome 11 at 100,383,576 bp
  • T to A, chromosome 12 at 81,315,986 bp
  • T to A, chromosome 12 at 102,788,090 bp
  • T to C, chromosome 12 at 116,438,756 bp
  • A to G, chromosome 12 at 118,874,762 bp
  • T to C, chromosome 13 at 24,173,608 bp
  • T to A, chromosome 13 at 42,157,140 bp
  • G to T, chromosome 13 at 58,558,575 bp
  • C to T, chromosome 13 at 73,667,068 bp
  • T to C, chromosome 13 at 92,030,888 bp
  • C to G, chromosome 14 at 26,468,476 bp
  • T to C, chromosome 15 at 10,393,821 bp
  • A to T, chromosome 15 at 64,120,107 bp
  • G to T, chromosome 15 at 76,189,281 bp
  • T to C, chromosome 15 at 85,359,474 bp
  • C to A, chromosome 16 at 29,228,170 bp
  • T to G, chromosome 16 at 37,988,542 bp
  • T to G, chromosome 16 at 55,991,620 bp
  • A to G, chromosome 17 at 23,291,211 bp
  • T to A, chromosome 17 at 24,595,132 bp
  • A to G, chromosome 17 at 29,378,462 bp
  • T to C, chromosome 17 at 49,071,225 bp
  • G to A, chromosome 17 at 85,088,357 bp
  • G to C, chromosome 18 at 12,549,227 bp
  • A to T, chromosome 18 at 58,053,659 bp
  • G to T, chromosome 18 at 80,450,213 bp
  • C to A, chromosome 19 at 6,250,616 bp
  • A to T, chromosome 19 at 10,091,829 bp
  • A to G, chromosome 19 at 53,233,678 bp
  • G to T, chromosome 19 at 53,909,243 bp
  • T to G, chromosome 19 at 56,380,322 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1437 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039492-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.