Strain Name:
C57BL/6J-MtgxR1445Btlr/Mmmh
Stock Number:
039500-MU
Citation ID:
RRID:MMRRC_039500-MU
Other Names:
R1445 (G1), C57BL/6J-MtgxR1445Btlr
Major Collection:

Gene Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Ptprz1
Name: protein tyrosine phosphatase, receptor type Z, polypeptide 1
Synonyms: PTPzeta, PTPbeta, Rptpbeta, Ptpz, phosphacan, DSD-1-PG, RPTPz, Ptprz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Upf1
Name: UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms: PNORF-1, Rent1, B430202H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Mga
Name: MAX gene associated
Synonyms: Mad5, Mga, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 29808
Homologene: 49351
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Plcb4
Name: phospholipase C, beta 4
Synonyms: A930039J07Rik, C230058B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Epc1
Name: enhancer of polycomb homolog 1
Synonyms: 2400007E14Rik, A930032N02Rik, 5730566F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13831
Homologene: 32627
Dido1
Name: death inducer-obliterator 1
Synonyms: D130048F08Rik, dido, Datf1, 6720461J16Rik, DIO-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 23856
HGNC: HGNC:2680
Homologene: 34139
Mllt6
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms: Af17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 246198
HGNC: HGNC:7138
Homologene: 31347
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: Trap150, 9330151F09Rik, B230333E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230753
Homologene: 31289
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: D130072O21Rik, TANK1, mTNKS1, tankyrase 1, 4930554K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 21951
Homologene: 18405
Ctbp1
Name: C-terminal binding protein 1
Synonyms: CtBP3/BARS, CtBP1-L, D5H4S115, D5H4S115E, BARS, D4S115h, CtBP1-S
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13016
HGNC: HGNC:2494
Homologene: 1015
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: argonaute 3, C130014L07Rik, eIF2C3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 214150
Homologene: 49799
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D15F32S1h, D7H15F37S1, jdf2, rjs, D7H15F32S1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: Murr2, A530081C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17847
Homologene: 40978
Pold1
Name: polymerase (DNA directed), delta 1, catalytic subunit
Synonyms: 125kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18971
HGNC: HGNC:9175
Homologene: 2014
Mars1
Name: methionine-tRNA synthetase 1
Synonyms: methionine tRNA ligase, methionyl-tRNA synthetase, MetRS, Mars
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216443
HGNC: HGNC:6898
Homologene: 90878
Marf1
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Atg13
Name: autophagy related 13
Synonyms: D2Ertd391e, 1110053A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 51897
Homologene: 32229
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: E430018P19Rik, chromatin remodeling factor, 8030453L17Rik, KMT2H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192195
Homologene: 10225
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, LOC381341, Dnahc7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Dsp
Name: desmoplakin
Synonyms: 5730453H04Rik, DP, rul, 2300002E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Eif2ak1
Name: eukaryotic translation initiation factor 2 alpha kinase 1
Synonyms: Hri
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15467
Homologene: 8290
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, Tnrc15, 2610016F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227331
Homologene: 41048
Crip2
Name: cysteine rich protein 2
Synonyms: Crp, Hlp, CRP4, ESP1, 0610010I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68337
HGNC: HGNC:2361
Homologene: 133917
Aspn
Name: asporin
Synonyms: 4631401G09Rik, PLAP-1, SLRR1C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 66695
VEGA: 13
Homologene: 32357
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: retinoblastoma-like 1 (p107), p107
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Gtpbp1
Name: GTP binding protein 1
Synonyms: GP-1, GTPBP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 14904
VEGA: 15
HGNC: HGNC:4669
Homologene: 3165
Chd1l
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: Snf2p, 4432404A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 68058
HGNC: HGNC:1916
Homologene: 11590
Cwc22
Name: CWC22 spliceosome-associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 80744
Homologene: 6048
Usp33
Name: ubiquitin specific peptidase 33
Synonyms: 9830169D19Rik, Vdu1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170822
Homologene: 8996
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930543C13Rik, 4930516E05Rik, D330038K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 171395
Homologene: 51376
Tmprss4
Name: transmembrane protease, serine 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214523
Homologene: 80930
Abca16
Name: ATP-binding cassette, sub-family A (ABC1), member 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233810
Homologene: 132942
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Trpc6
Name: transient receptor potential cation channel, subfamily C, member 6
Synonyms: Trrp6, mtrp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22068
VEGA: 9
Homologene: 37944
Cep164
Name: centrosomal protein 164
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214552
Homologene: 51110
Pigo
Name: phosphatidylinositol glycan anchor biosynthesis, class O
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56703
Homologene: 31761
Aldh1a2
Name: aldehyde dehydrogenase family 1, subfamily A2
Synonyms: Aldh1a7, Raldh2, retinaldehyde dehydrogenase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19378
Homologene: 68368
Ptprq
Name: protein tyrosine phosphatase, receptor type, Q
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: PKHDL1, fibrocystin L, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Aplnr
Name: apelin receptor
Synonyms: apelin receptor, msr/apj, Agtrl1, APJ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 23796
HGNC: HGNC:339
Homologene: 3784
Vmn1r78
Name: vomeronasal 1 receptor 78
Synonyms: V1rg7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171242
Homologene: 74316
Tcp10a
Name: t-complex protein 10a
Synonyms: D17Leh66A, T66A-a, D17Leh66aa, Tcp-10a, Gm10326
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21461
Homologene: 83254
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: X83337, ESTM15, 1810073P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75607
Homologene: 19155
Ubtd2
Name: ubiquitin domain containing 2
Synonyms: 9630054F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327900
Homologene: 15484
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: alpha(1B), Cchn1a, Cav2.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Col9a1
Name: collagen, type IX, alpha 1
Synonyms: Col9a-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12839
HGNC: HGNC:2217
Homologene: 1393
Megf8
Name: multiple EGF-like-domains 8
Synonyms: b2b288Clo, b2b1702Clo, Egfl4, m687Ddg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268527
Homologene: 8780
Agap2
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
Mrpl37
Name: mitochondrial ribosomal protein L37
Synonyms: 2300004O14Rik, MRP-L2, Rpml2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56280
Homologene: 9536
Mat1a
Name: methionine adenosyltransferase I, alpha
Synonyms: Ams, AdoMet, SAMS, MAT, SAMS1, MATA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11720
VEGA: 14
HGNC: HGNC:6903
Homologene: 68057
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Themis2
Name: thymocyte selection associated family member 2
Synonyms: ICB-1, BC013712
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230787
Homologene: 21009
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, 1700052O22Rik, 4931438M07Rik, MX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Trim43c
Name: tripartite motif-containing 43C
Synonyms: Trim43
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 666731
Homologene: 105432
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Actn3
Name: actinin alpha 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 11474
HGNC: HGNC:165
Homologene: 862
Mylk
Name: myosin, light polypeptide kinase
Synonyms: MLCK108, nmMlck, MLCK210, Mlck, 9530072E15Rik, telokin, A930019C19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Hck
Name: hemopoietic cell kinase
Synonyms: Hck-1, Bmk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15162
HGNC: HGNC:4840
Homologene: 20489
Mtnr1a
Name: melatonin receptor 1A
Synonyms: Mel1a receptor, MelR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17773
HGNC: HGNC:7463
Homologene: 21207
Slc27a1
Name: solute carrier family 27 (fatty acid transporter), member 1
Synonyms: FATP1, Fatp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 26457
Homologene: 8063
Tinag
Name: tubulointerstitial nephritis antigen
Synonyms: TIN-ag
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 26944
Homologene: 8082
B3glct
Name: beta-3-glucosyltransferase
Synonyms: LOC381694, B3galtl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381694
Homologene: 14978
Atp1b2
Name: ATPase, Na+/K+ transporting, beta 2 polypeptide
Synonyms: Amog, Atpb-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11932
HGNC: HGNC:805
Homologene: 36075
Vmn2r7
Name: vomeronasal 2, receptor 7
Synonyms: 4933425M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 319217
Homologene: 129754
Fam189a2
Name: family with sequence similarity 189, member A2
Synonyms: LOC381217
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381217
VEGA: 19
Homologene: 3540
Chst8
Name: carbohydrate sulfotransferase 8
Synonyms: 1500011J21Rik, GalNAc4ST-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68947
Homologene: 41483
Cobll1
Name: Cobl-like 1
Synonyms: D430044D16Rik, Coblr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319876
Homologene: 8933
Alkbh2
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: mABH2, Abh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231642
Homologene: 18393
Pygm
Name: muscle glycogen phosphorylase
Synonyms: PG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 19309
HGNC: HGNC:9726
Homologene: 2145
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: D13Ertd275e, 2810430O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Cyp4a32
Name: cytochrome P450, family 4, subfamily a, polypeptide 32
Synonyms: OTTMUSG00000008689
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100040843
HGNC: HGNC:2642
Homologene: 128044
Sorbs3
Name: sorbin and SH3 domain containing 3
Synonyms: Sh3d4, vinexin alpha, vinexin beta, SH3P3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 20410
VEGA: 14
Homologene: 4218
AC145553.3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Olfr738
Name: olfactory receptor 738
Synonyms: MOR106-3, GA_x6K02T2PMLR-6110726-6111661
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258662
Homologene: 74220
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: D1Mgi1, 9230107O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Zpbp2
Name: zona pellucida binding protein 2
Synonyms: 1700017D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69376
Homologene: 18892
Ubxn6
Name: UBX domain protein 6
Synonyms: 2210415J11Rik, 1200008L11Rik, Ubxdc2, Ubxd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 66530
Homologene: 11538
Smpd1
Name: sphingomyelin phosphodiesterase 1, acid lysosomal
Synonyms: aSMase, acid sphingomyelinase, ASM, A-SMase, Zn-SMase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20597
Homologene: 457
Stfa2l1
Name: stefin A2 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 268885
VEGA: 16
HGNC: HGNC:2481
Homologene: 86269
Sox1ot
Name: Sox1 overlapping transcript
Synonyms: Gm5607
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 434280
Slc26a8
Name: solute carrier family 26, member 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224661
Homologene: 27095
Clec4n
Name: C-type lectin domain family 4, member n
Synonyms: Clecsf10, dectin-2, Nkcl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56620
Homologene: 84615
Pacc1
Name: proton activated chloride channel 1
Synonyms: 2310028N02Rik, Tmem206
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66950
Homologene: 10097
Syndig1
Name: synapse differentiation inducing 1
Synonyms: SynDIG1, Tmem90b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 433485
Homologene: 11771
Wfdc11
Name: WAP four-disulfide core domain 11
Synonyms: OTTMUSG00000016290
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 629761
Homologene: 136267
Lrat
Name: lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Synonyms: 1300010A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 79235
HGNC: HGNC:6685
Homologene: 3483
1700061I17Rik
Name: RIKEN cDNA 1700061I17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 433646
Tmod1
Name: tropomodulin 1
Synonyms: E-Tmod, erythrocyte tropomodulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 21916
Homologene: 20701
2300003K06Rik
Name: RIKEN cDNA 2300003K06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100502865
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 21,405,024 bp
  • T to C, chromosome 1 at 24,237,498 bp
  • G to A, chromosome 1 at 53,528,797 bp
  • A to G, chromosome 1 at 87,443,638 bp
  • A to G, chromosome 1 at 191,348,362 bp
  • G to A, chromosome 2 at 24,718,136 bp
  • A to T, chromosome 2 at 65,099,136 bp
  • T to C, chromosome 2 at 77,917,177 bp
  • A to G, chromosome 2 at 85,137,009 bp
  • A to T, chromosome 2 at 91,679,990 bp
  • T to C, chromosome 2 at 119,902,698 bp
  • A to T, chromosome 2 at 136,000,189 bp
  • A to G, chromosome 2 at 149,930,921 bp
  • A to T, chromosome 2 at 153,128,272 bp
  • T to C, chromosome 2 at 157,193,098 bp
  • T to C, chromosome 2 at 164,664,446 bp
  • G to T, chromosome 2 at 180,671,470 bp
  • T to A, chromosome 3 at 64,724,802 bp
  • T to G, chromosome 3 at 82,903,369 bp
  • T to C, chromosome 3 at 89,007,352 bp
  • C to T, chromosome 3 at 97,582,731 bp
  • G to T, chromosome 3 at 117,067,736 bp
  • A to T, chromosome 3 at 122,523,191 bp
  • A to G, chromosome 3 at 152,368,634 bp
  • A to T, chromosome 4 at 43,021,460 bp
  • T to C, chromosome 4 at 46,090,884 bp
  • A to G, chromosome 4 at 107,064,495 bp
  • C to A, chromosome 4 at 115,602,950 bp
  • T to C, chromosome 4 at 126,176,336 bp
  • C to A, chromosome 4 at 126,371,787 bp
  • T to A, chromosome 4 at 132,782,901 bp
  • C to T, chromosome 5 at 33,261,063 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • G to T, chromosome 5 at 143,873,899 bp
  • A to T, chromosome 5 at 149,754,139 bp
  • A to G, chromosome 6 at 23,050,474 bp
  • A to G, chromosome 6 at 123,235,516 bp
  • A to G, chromosome 7 at 12,152,581 bp
  • T to C, chromosome 7 at 25,342,656 bp
  • C to T, chromosome 7 at 33,279,612 bp
  • C to A, chromosome 7 at 34,748,168 bp
  • C to T, chromosome 7 at 44,542,757 bp
  • T to C, chromosome 7 at 56,168,996 bp
  • T to C, chromosome 7 at 80,368,562 bp
  • A to G, chromosome 7 at 105,556,674 bp
  • T to C, chromosome 7 at 120,520,033 bp
  • A to T, chromosome 8 at 12,429,905 bp
  • A to C, chromosome 8 at 34,834,603 bp
  • G to T, chromosome 8 at 45,087,745 bp
  • T to A, chromosome 8 at 70,341,524 bp
  • T to A, chromosome 8 at 71,584,113 bp
  • T to A, chromosome 8 at 81,952,834 bp
  • T to C, chromosome 8 at 125,752,284 bp
  • A to G, chromosome 9 at 8,680,537 bp
  • T to A, chromosome 9 at 45,184,385 bp
  • T to G, chromosome 9 at 45,778,900 bp
  • T to C, chromosome 9 at 71,285,210 bp
  • C to A, chromosome 9 at 77,045,516 bp
  • GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
  • A to G, chromosome 9 at 109,108,921 bp
  • A to G, chromosome 10 at 12,678,574 bp
  • T to C, chromosome 10 at 107,662,562 bp
  • T to A, chromosome 10 at 127,091,112 bp
  • T to C, chromosome 10 at 127,297,988 bp
  • A to T, chromosome 11 at 8,870,313 bp
  • A to G, chromosome 11 at 23,351,629 bp
  • C to T, chromosome 11 at 32,516,125 bp
  • T to A, chromosome 11 at 34,239,705 bp
  • T to A, chromosome 11 at 69,602,483 bp
  • T to C, chromosome 11 at 97,672,451 bp
  • C to A, chromosome 11 at 98,553,844 bp
  • G to T, chromosome 11 at 99,837,967 bp
  • T to C, chromosome 12 at 8,016,084 bp
  • T to G, chromosome 12 at 16,707,851 bp
  • T to C, chromosome 12 at 113,143,504 bp
  • A to G, chromosome 13 at 13,640,054 bp
  • A to G, chromosome 13 at 38,191,931 bp
  • C to T, chromosome 13 at 49,071,110 bp
  • T to C, chromosome 13 at 49,557,373 bp
  • A to T, chromosome 13 at 117,025,350 bp
  • T to C, chromosome 14 at 41,121,840 bp
  • A to G, chromosome 14 at 50,414,401 bp
  • A to G, chromosome 14 at 70,193,646 bp
  • T to C, chromosome 15 at 44,505,644 bp
  • T to C, chromosome 15 at 79,713,448 bp
  • C to T, chromosome 16 at 14,115,824 bp
  • T to C, chromosome 16 at 34,815,465 bp
  • T to C, chromosome 16 at 36,161,784 bp
  • G to A, chromosome 17 at 7,326,007 bp
  • C to T, chromosome 17 at 28,648,213 bp
  • T to C, chromosome 17 at 56,069,042 bp
  • A to T, chromosome 18 at 6,452,360 bp
  • C to T, chromosome 19 at 4,865,455 bp
  • G to A, chromosome 19 at 6,389,887 bp
  • G to T, chromosome 19 at 16,701,238 bp
  • G to A, chromosome 19 at 24,021,634 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1445 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
039500-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.