Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1445Btlr/Mmmh
Stock Number:
039500-MU
Citation ID:
RRID:MMRRC_039500-MU
Other Names:
R1445 (G1), C57BL/6J-MtgxR1445Btlr
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 21,405,024 bp
  • T to C, chromosome 1 at 24,237,498 bp
  • G to A, chromosome 1 at 53,528,797 bp
  • A to G, chromosome 1 at 87,443,638 bp
  • A to G, chromosome 1 at 191,348,362 bp
  • G to A, chromosome 2 at 24,718,136 bp
  • A to T, chromosome 2 at 65,099,136 bp
  • T to C, chromosome 2 at 77,917,177 bp
  • A to G, chromosome 2 at 85,137,009 bp
  • A to T, chromosome 2 at 91,679,990 bp
  • T to C, chromosome 2 at 119,902,698 bp
  • A to T, chromosome 2 at 136,000,189 bp
  • A to G, chromosome 2 at 149,930,921 bp
  • A to T, chromosome 2 at 153,128,272 bp
  • T to C, chromosome 2 at 157,193,098 bp
  • T to C, chromosome 2 at 164,664,446 bp
  • G to T, chromosome 2 at 180,671,470 bp
  • T to A, chromosome 3 at 64,724,802 bp
  • T to G, chromosome 3 at 82,903,369 bp
  • T to C, chromosome 3 at 89,007,352 bp
  • C to T, chromosome 3 at 97,582,731 bp
  • G to T, chromosome 3 at 117,067,736 bp
  • A to T, chromosome 3 at 122,523,191 bp
  • A to G, chromosome 3 at 152,368,634 bp
  • A to T, chromosome 4 at 43,021,460 bp
  • T to C, chromosome 4 at 46,090,884 bp
  • A to G, chromosome 4 at 107,064,495 bp
  • C to A, chromosome 4 at 115,602,950 bp
  • T to C, chromosome 4 at 126,176,336 bp
  • C to A, chromosome 4 at 126,371,787 bp
  • T to A, chromosome 4 at 132,782,901 bp
  • C to T, chromosome 5 at 33,261,063 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • G to T, chromosome 5 at 143,873,899 bp
  • A to T, chromosome 5 at 149,754,139 bp
  • A to G, chromosome 6 at 23,050,474 bp
  • A to G, chromosome 6 at 123,235,516 bp
  • A to G, chromosome 7 at 12,152,581 bp
  • T to C, chromosome 7 at 25,342,656 bp
  • C to T, chromosome 7 at 33,279,612 bp
  • C to A, chromosome 7 at 34,748,168 bp
  • C to T, chromosome 7 at 44,542,757 bp
  • T to C, chromosome 7 at 56,168,996 bp
  • T to C, chromosome 7 at 80,368,562 bp
  • A to G, chromosome 7 at 105,556,674 bp
  • T to C, chromosome 7 at 120,520,033 bp
  • A to T, chromosome 8 at 12,429,905 bp
  • A to C, chromosome 8 at 34,834,603 bp
  • G to T, chromosome 8 at 45,087,745 bp
  • T to A, chromosome 8 at 70,341,524 bp
  • T to A, chromosome 8 at 71,584,113 bp
  • T to A, chromosome 8 at 81,952,834 bp
  • T to C, chromosome 8 at 125,752,284 bp
  • A to G, chromosome 9 at 8,680,537 bp
  • T to A, chromosome 9 at 45,184,385 bp
  • T to G, chromosome 9 at 45,778,900 bp
  • T to C, chromosome 9 at 71,285,210 bp
  • C to A, chromosome 9 at 77,045,516 bp
  • GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
  • A to G, chromosome 9 at 109,108,921 bp
  • A to G, chromosome 10 at 12,678,574 bp
  • T to C, chromosome 10 at 107,662,562 bp
  • T to A, chromosome 10 at 127,091,112 bp
  • T to C, chromosome 10 at 127,297,988 bp
  • A to T, chromosome 11 at 8,870,313 bp
  • A to G, chromosome 11 at 23,351,629 bp
  • C to T, chromosome 11 at 32,516,125 bp
  • T to A, chromosome 11 at 34,239,705 bp
  • T to A, chromosome 11 at 69,602,483 bp
  • T to C, chromosome 11 at 97,672,451 bp
  • C to A, chromosome 11 at 98,553,844 bp
  • G to T, chromosome 11 at 99,837,967 bp
  • T to C, chromosome 12 at 8,016,084 bp
  • T to G, chromosome 12 at 16,707,851 bp
  • T to C, chromosome 12 at 113,143,504 bp
  • A to G, chromosome 13 at 13,640,054 bp
  • A to G, chromosome 13 at 38,191,931 bp
  • C to T, chromosome 13 at 49,071,110 bp
  • T to C, chromosome 13 at 49,557,373 bp
  • A to T, chromosome 13 at 117,025,350 bp
  • T to C, chromosome 14 at 41,121,840 bp
  • A to G, chromosome 14 at 50,414,401 bp
  • A to G, chromosome 14 at 70,193,646 bp
  • T to C, chromosome 15 at 44,505,644 bp
  • T to C, chromosome 15 at 79,713,448 bp
  • C to T, chromosome 16 at 14,115,824 bp
  • T to C, chromosome 16 at 34,815,465 bp
  • T to C, chromosome 16 at 36,161,784 bp
  • G to A, chromosome 17 at 7,326,007 bp
  • C to T, chromosome 17 at 28,648,213 bp
  • T to C, chromosome 17 at 56,069,042 bp
  • A to T, chromosome 18 at 6,452,360 bp
  • C to T, chromosome 19 at 4,865,455 bp
  • G to A, chromosome 19 at 6,389,887 bp
  • G to T, chromosome 19 at 16,701,238 bp
  • G to A, chromosome 19 at 24,021,634 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1445 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039500-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.