Strain Name:
C57BL/6J-MtgxR1570Btlr/Mmmh
Stock Number:
039609-MU
Citation ID:
RRID:MMRRC_039609-MU
Other Names:
R1570 (G1), C57BL/6J-MtgxR1570Btlr
Major Collection:

Strain Information

Pi4k2a
Name: phosphatidylinositol 4-kinase type 2 alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 84095
VEGA: 19
Homologene: 101681
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: Cerp, PRCE, separase, SSE, ESP1, PRCE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Btc
Name: betacellulin, epidermal growth factor family member
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12223
HGNC: HGNC:1121
Homologene: 1309
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268515
Homologene: 129585
Zfp423
Name: zinc finger protein 423
Synonyms: Ebfaz, Roaz, ataxia1, Zfp104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94187
Homologene: 9010
Tacr3
Name: tachykinin receptor 3
Synonyms: neuromedin K receptor, Nk3r, Tac3r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 21338
Homologene: 824
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: ARHGAP10, 5530401C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71435
Homologene: 10822
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: AD013, A330063D19Rik, 1810014J18Rik, 9030205D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 109151
Homologene: 11844
Cep170
Name: centrosomal protein 170
Synonyms: A330004A13Rik, 4933426L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545389
Homologene: 22844
Nup133
Name: nucleoporin 133
Synonyms: mermaid, 4832420O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234865
Homologene: 32402
Nbr1
Name: NBR1, autophagy cargo receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17966
HGNC: HGNC:6746
Homologene: 7438
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 64898
Homologene: 8769
Nup107
Name: nucleoporin 107
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103468
VEGA: 10
Homologene: 5555
Otud7b
Name: OTU domain containing 7B
Synonyms: 2900060B22Rik, 4930463P07Rik, Za20d1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229603
Homologene: 10624
Apobec1
Name: apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11810
HGNC: HGNC:604
Homologene: 1243
Lmbr1
Name: limb region 1
Synonyms: 1110048D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56873
Homologene: 49706
Glrx5
Name: glutaredoxin 5
Synonyms: 2900070E19Rik, 2310004O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 73046
VEGA: 12
Homologene: 31984
Lpin1
Name: lipin 1
Synonyms: Lipin1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 14245
VEGA: 12
Homologene: 9266
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: 1500010O20Rik, Neph2, 2900036G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67703
Homologene: 57050
Cdhr5
Name: cadherin-related family member 5
Synonyms: Mucdhl, Mupcdh, 1810074H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72040
HGNC: HGNC:7521
Homologene: 69345
Zfp59
Name: zinc finger protein 59
Synonyms: Mfg2, Mfg-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22717
Homologene: 137243
Clk1
Name: CDC-like kinase 1
Synonyms: STY, Clk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12747
HGNC: HGNC:2068
Homologene: 101535
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: 4432416O06Rik, m407Asp, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo, m152Asp, D030010H02Rik, DHC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
R3hcc1l
Name: R3H domain and coiled-coil containing 1 like
Synonyms: 1700036B12Rik, D19Ertd386e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 52013
Homologene: 8707
Caap1
Name: caspase activity and apoptosis inhibitor 1
Synonyms: 5830433M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67770
Homologene: 32607
Ino80
Name: INO80 complex subunit
Synonyms: 4632409L19Rik, 2310079N15Rik, INO80, Inoc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68142
Homologene: 75070
Rpl24
Name: ribosomal protein L24
Synonyms: Bst, 0610008L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 68193
Homologene: 763
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MTSG1, Atip1, B430305I03Rik, MD44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102103
Homologene: 100292
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: 2010309L07Rik, IRAP, vp165, 4732490P18Rik, gp160
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Gpr155
Name: G protein-coupled receptor 155
Synonyms: DEPDC3, F730029F15Rik, 1110017O10Rik, PGR22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68526
Homologene: 16584
Lcp2
Name: lymphocyte cytosolic protein 2
Synonyms: SLP76, twm, SLP-76, m1Khoe
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16822
HGNC: HGNC:6529
Homologene: 4065
Spink5
Name: serine peptidase inhibitor, Kazal type 5
Synonyms: 2310065D10Rik, LEKT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 72432
Homologene: 4987
Sox6
Name: SRY (sex determining region Y)-box 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20679
Homologene: 22631
Scin
Name: scinderin
Synonyms: adseverin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20259
Homologene: 36296
Ccr5
Name: chemokine (C-C motif) receptor 5
Synonyms: Cmkbr5, CD195
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12774
HGNC: HGNC:1606
Homologene: 37325
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Asb8
Name: ankyrin repeat and SOCS box-containing 8
Synonyms: 4930539L19Rik, C430011H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78541
Homologene: 32572
Cyp4b1
Name: cytochrome P450, family 4, subfamily b, polypeptide 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13120
HGNC: HGNC:2644
Homologene: 128045
Plpp6
Name: phospholipid phosphatase 6
Synonyms: 4932443D16Rik, Ppapdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 74411
Homologene: 45228
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: Gm884, LOC380730
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380730
Homologene: 134511
Cd109
Name: CD109 antigen
Synonyms: 9930012E15Rik, Gov platelet alloantigens
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235505
Homologene: 25183
Ephx4
Name: epoxide hydrolase 4
Synonyms: Abhd7, LOC384214
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384214
Homologene: 62402
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Col4a-1, Del(8)44H, Del(8)Bru44H, alpha1(IV) collagen, Raw, Svc, Bru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Ildr2
Name: immunoglobulin-like domain containing receptor 2
Synonyms: 2810478N18Rik, Dbsm1, D1Ertd471e, ENSMUSG00000040612, OTTMUSG00000021748, 3110063L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100039795
Homologene: 52388
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 545527
Homologene: 65043
Serpinb1c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 1c
Synonyms: EIC, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 380839
HGNC: HGNC:3311
Homologene: 137840
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432486
Homologene: 32576
Or52b4i
Name: olfactory receptor family 52 subfamily B member 4I
Synonyms: GA_x6K02T2PBJ9-5263046-5263989, Olfr548, MOR31-13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258229
Snx19
Name: sorting nexin 19
Synonyms: 3526401K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102607
VEGA: 9
Homologene: 8846
St6galnac1
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Synonyms: Siat7a, ST6GalNAc I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20445
Homologene: 7937
Dao
Name: D-amino acid oxidase
Synonyms: Dao1, Dao-1, DAO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13142
HGNC: HGNC:2671
Homologene: 37553
Or8i2
Name: olfactory receptor family 8 subfamily I member 2
Synonyms: GA_x6K02T2Q125-48508763-48507833, MOR207-1, Olfr1104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258763
Homologene: 64916
Hsd11b1
Name: hydroxysteroid 11-beta dehydrogenase 1
Synonyms: 11beta-HSD-1, 11beta-hydroxysteroid dehydrogenase type 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15483
HGNC: HGNC:5208
Homologene: 68471
Or3a10
Name: olfactory receptor family 3 subfamily A member 10
Synonyms: Olfr139, M5, MOR255-2, GA_x6K02T2P1NL-4202012-4201065
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 259005
Homologene: 77386
Or2a20
Name: olfactory receptor family 2 subfamily A member 2
Synonyms: GA_x6K02T2P3E9-4341246-4340281, Olfr434, MOR261-10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258366
Homologene: 133700
Pira13
Name: paired-Ig-like receptor A13
Synonyms: ENSMUSG00000074419, Gm15448
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100041146
HGNC: HGNC:6609
Homologene: 134028
Armh1
Name: armadillo-like helical domain containing 1
Synonyms: LOC381543, Ncrna00082, Gm1661, LOC381544
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381544
Homologene: 28727
Sorcs3
Name: sortilin-related VPS10 domain containing receptor 3
Synonyms: 6330404A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66673
VEGA: 19
Homologene: 8986
Pih1d2
Name: PIH1 domain containing 2
Synonyms: 2700059L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72614
Homologene: 12474
Lrrc45
Name: leucine rich repeat containing 45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217366
Homologene: 17019
Arl5c
Name: ADP-ribosylation factor-like 5C
Synonyms: Arl12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217151
Homologene: 28456
Or4n4
Name: olfactory receptor family 4 subfamily N member 4
Synonyms: MOR241-1, Olfr732, GA_x6K02T2PMLR-5975274-5974348
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258659
Homologene: 72012
C1s2
Name: complement component 1, s subcomponent 2
Synonyms: Gm5077
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 317677
HGNC: HGNC:1247
Homologene: 1314
Sult1c2
Name: sulfotransferase family, cytosolic, 1C, member 2
Synonyms: ST1C1, 1810008N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 69083
Homologene: 38201
4921506M07Rik
Name: RIKEN cDNA 4921506M07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Or4p8
Name: olfactory receptor family 4 subfamily P member 8
Synonyms: GA_x6K02T2Q125-50372411-50371485, Olfr1208, MOR225-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258774
Homologene: 74190
Evi2b
Name: ecotropic viral integration site 2b
Synonyms: Evi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216984
HGNC: HGNC:3500
Homologene: 48438
Rnf25
Name: ring finger protein 25
Synonyms: 0610009H16Rik, AO7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 57751
Homologene: 11193
Zscan2
Name: zinc finger and SCAN domain containing 2
Synonyms: Zfp29, Zfp-29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22691
Homologene: 56453
Spmip10
Name: sperm microtubule inner protein 10
Synonyms: 1700065I17Rik, Tex43
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67343
Homologene: 77918
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 58,414,425 bp
  • T to C, chromosome 1 at 74,595,267 bp
  • T to C, chromosome 1 at 166,303,585 bp
  • A to G, chromosome 1 at 176,755,801 bp
  • C to G, chromosome 1 at 193,240,327 bp
  • G to T, chromosome 2 at 20,880,840 bp
  • T to C, chromosome 2 at 73,370,038 bp
  • A to T, chromosome 2 at 87,022,272 bp
  • A to C, chromosome 2 at 88,896,946 bp
  • C to T, chromosome 2 at 119,447,028 bp
  • C to T, chromosome 3 at 58,630,659 bp
  • T to C, chromosome 3 at 96,155,891 bp
  • T to G, chromosome 3 at 134,829,756 bp
  • C to T, chromosome 4 at 94,556,577 bp
  • G to A, chromosome 4 at 115,635,963 bp
  • A to G, chromosome 4 at 117,229,992 bp
  • A to G, chromosome 5 at 29,254,558 bp
  • T to C, chromosome 5 at 91,402,717 bp
  • A to G, chromosome 5 at 107,419,851 bp
  • T to C, chromosome 5 at 114,023,937 bp
  • T to C, chromosome 6 at 43,217,351 bp
  • A to G, chromosome 6 at 122,591,085 bp
  • G to A, chromosome 6 at 124,625,764 bp
  • T to C, chromosome 7 at 3,823,061 bp
  • T to C, chromosome 7 at 27,853,591 bp
  • C to A, chromosome 7 at 80,863,393 bp
  • C to A, chromosome 7 at 102,541,970 bp
  • C to A, chromosome 7 at 115,777,123 bp
  • C to A, chromosome 7 at 141,271,769 bp
  • C to T, chromosome 8 at 11,223,683 bp
  • A to G, chromosome 8 at 41,076,241 bp
  • A to C, chromosome 8 at 87,782,558 bp
  • A to T, chromosome 8 at 91,036,542 bp
  • T to A, chromosome 8 at 123,949,176 bp
  • A to G, chromosome 9 at 7,176,926 bp
  • A to G, chromosome 9 at 30,428,343 bp
  • A to T, chromosome 9 at 34,944,533 bp
  • T to C, chromosome 9 at 50,621,179 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • T to C, chromosome 9 at 124,124,963 bp
  • T to A, chromosome 10 at 88,419,454 bp
  • A to G, chromosome 10 at 117,763,844 bp
  • A to G, chromosome 11 at 34,089,601 bp
  • T to C, chromosome 11 at 66,112,330 bp
  • A to C, chromosome 11 at 74,044,807 bp
  • T to A, chromosome 11 at 79,516,250 bp
  • A to G, chromosome 11 at 97,992,387 bp
  • T to C, chromosome 11 at 101,564,830 bp
  • A to G, chromosome 11 at 103,609,938 bp
  • A to G, chromosome 11 at 116,766,648 bp
  • G to A, chromosome 11 at 120,272,183 bp
  • T to C, chromosome 11 at 120,720,109 bp
  • T to C, chromosome 12 at 16,560,998 bp
  • G to A, chromosome 12 at 40,084,381 bp
  • T to C, chromosome 12 at 57,674,763 bp
  • A to G, chromosome 12 at 105,032,868 bp
  • A to T, chromosome 13 at 32,896,990 bp
  • T to G, chromosome 14 at 50,281,524 bp
  • A to G, chromosome 15 at 98,136,428 bp
  • A to G, chromosome 15 at 102,298,367 bp
  • C to A, chromosome 16 at 55,990,815 bp
  • A to T, chromosome 17 at 17,579,156 bp
  • T to C, chromosome 17 at 53,836,963 bp
  • T to A, chromosome 17 at 71,245,181 bp
  • A to G, chromosome 18 at 43,967,107 bp
  • T to A, chromosome 18 at 56,594,534 bp
  • T to C, chromosome 19 at 28,964,778 bp
  • T to C, chromosome 19 at 42,100,644 bp
  • A to T, chromosome 19 at 42,581,954 bp
  • A to G, chromosome 19 at 48,764,181 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1570 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039609-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.