Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1601Btlr/Mmmh
Stock Number:
039638-MU
Citation ID:
RRID:MMRRC_039638-MU
Other Names:
R1601 (G1), C57BL/6J-MtgxR1601Btlr
Major Collection:

Strain Information

Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: 9330151F09Rik, Trap150, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Nomo1
Name: nodal modulator 1
Synonyms: PM5, Nomo, D7Ertd156e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211548
Homologene: 13810
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,549,802 bp
  • A to T, chromosome 1 at 92,917,222 bp
  • T to A, chromosome 1 at 180,065,001 bp
  • A to T, chromosome 1 at 181,919,620 bp
  • T to C, chromosome 1 at 190,161,006 bp
  • A to G, chromosome 2 at 14,293,437 bp
  • A to T, chromosome 2 at 52,287,252 bp
  • C to A, chromosome 2 at 131,520,174 bp
  • A to G, chromosome 2 at 156,333,631 bp
  • A to G, chromosome 2 at 170,485,691 bp
  • A to T, chromosome 2 at 180,197,745 bp
  • G to A, chromosome 3 at 68,870,213 bp
  • G to T, chromosome 3 at 96,653,658 bp
  • T to A, chromosome 3 at 138,896,835 bp
  • A to G, chromosome 4 at 35,205,897 bp
  • T to A, chromosome 4 at 56,774,756 bp
  • C to G, chromosome 4 at 126,180,101 bp
  • T to C, chromosome 4 at 129,992,837 bp
  • T to C, chromosome 4 at 130,308,848 bp
  • T to C, chromosome 4 at 134,238,249 bp
  • C to T, chromosome 5 at 5,135,378 bp
  • A to G, chromosome 5 at 97,111,389 bp
  • G to T, chromosome 5 at 112,871,498 bp
  • A to G, chromosome 5 at 121,632,675 bp
  • A to G, chromosome 5 at 147,033,519 bp
  • A to G, chromosome 6 at 125,185,772 bp
  • T to G, chromosome 7 at 4,552,638 bp
  • T to C, chromosome 7 at 15,867,811 bp
  • C to T, chromosome 7 at 28,748,971 bp
  • C to A, chromosome 7 at 46,046,955 bp
  • T to C, chromosome 7 at 110,340,076 bp
  • A to G, chromosome 8 at 11,782,638 bp
  • G to T, chromosome 8 at 13,465,786 bp
  • G to T, chromosome 8 at 24,576,189 bp
  • T to C, chromosome 8 at 27,110,018 bp
  • T to C, chromosome 8 at 75,119,354 bp
  • A to T, chromosome 9 at 74,862,691 bp
  • G to A, chromosome 9 at 86,536,250 bp
  • A to C, chromosome 9 at 86,678,012 bp
  • A to G, chromosome 9 at 111,373,477 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 10 at 79,035,504 bp
  • C to T, chromosome 10 at 80,060,492 bp
  • T to C, chromosome 10 at 116,113,616 bp
  • C to T, chromosome 11 at 5,521,975 bp
  • A to G, chromosome 11 at 55,282,010 bp
  • A to T, chromosome 11 at 58,666,077 bp
  • T to C, chromosome 12 at 4,658,452 bp
  • A to G, chromosome 12 at 25,005,088 bp
  • C to T, chromosome 12 at 112,023,253 bp
  • C to A, chromosome 13 at 21,703,226 bp
  • A to T, chromosome 14 at 20,464,615 bp
  • A to C, chromosome 14 at 52,450,442 bp
  • A to G, chromosome 14 at 122,944,826 bp
  • A to G, chromosome 15 at 3,968,965 bp
  • T to C, chromosome 15 at 35,642,436 bp
  • A to T, chromosome 15 at 101,545,153 bp
  • T to A, chromosome 16 at 21,766,408 bp
  • C to A, chromosome 16 at 32,755,501 bp
  • A to G, chromosome 17 at 57,441,353 bp
  • A to G, chromosome 17 at 66,150,385 bp
  • A to T, chromosome 17 at 83,588,339 bp
  • G to A, chromosome 18 at 13,015,898 bp
  • A to G, chromosome 18 at 34,808,731 bp
  • T to C, chromosome 19 at 6,907,558 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1601 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039638-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.