Strain Name:
C57BL/6J-MtgxR1651Btlr/Mmmh
Stock Number:
039687-MU
Citation ID:
RRID:MMRRC_039687-MU
Other Names:
R1651 (G1), C57BL/6J-MtgxR1651Btlr
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: D15Ertd600e, myosin-X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: Dicer1, 1110006F08Rik, D12Ertd7e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: C030017F07Rik, C130076O07Rik, Bravo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: Cxxc6, BB001228, 2510010B09Rik, D10Ertd17e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 52463
Homologene: 12735
Actn4
Name: actinin alpha 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 60595
HGNC: HGNC:166
Homologene: 55857
Map1b
Name: microtubule-associated protein 1B
Synonyms: Mtap1b, Mtap-5, MAP5, LC1, Mtap5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18139
Homologene: 7447
Setd2
Name: SET domain containing 2
Synonyms: KMT3A, 4921524K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235626
Homologene: 56493
Smyd3
Name: SET and MYND domain containing 3
Synonyms: Zmynd1, 2410008A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69726
Homologene: 41491
Rbm27
Name: RNA binding motif protein 27
Synonyms: Psc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225432
VEGA: 18
Homologene: 35410
Trappc12
Name: trafficking protein particle complex 12
Synonyms: Ttc15, CGI-87, D930014A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217449
VEGA: 12
Homologene: 34805
Wdr7
Name: WD repeat domain 7
Synonyms: TRAG, TGF-beta resistance associated gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Chd4
Name: chromodomain helicase DNA binding protein 4
Synonyms: Mi-2beta, 9530019N15Rik, D6Ertd380e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 107932
HGNC: HGNC:1919
Homologene: 68175
Gabpb2
Name: GA repeat binding protein, beta 2
Synonyms: 9430006E19Rik, 1810015F01Rik, A430024B14Rik, Gabpb2-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 213054
Homologene: 34921
Arhgap32
Name: Rho GTPase activating protein 32
Synonyms: 3426406O18Rik, p200RhoGAP, Grit, GC-GAP, PX-RICS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330914
Homologene: 8812
Rasal1
Name: RAS protein activator like 1 (GAP1 like)
Synonyms: MRASAL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19415
HGNC: HGNC:9873
Homologene: 3423
Trim2
Name: tripartite motif-containing 2
Synonyms: narf, neural activity-related ring finger protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80890
Homologene: 22882
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101471
Homologene: 16377
Lrrtm4
Name: leucine rich repeat transmembrane neuronal 4
Synonyms: 7530419J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243499
Homologene: 11807
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, perlecan, Plc, Pcn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Crmp1
Name: collapsin response mediator protein 1
Synonyms: DRP-1, Ulip3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12933
HGNC: HGNC:2365
Homologene: 20347
Bpnt2
Name: 3'(2'), 5'-bisphosphate nucleotidase 2
Synonyms: 1110001C20Rik, Impad1, gPAPP, Jaws
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242291
Homologene: 9852
Nbeal1
Name: neurobeachin like 1
Synonyms: 2310076G13Rik, ALS2CR17, A530050O19Rik, A530083I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269198
Homologene: 16453
Tmprss4
Name: transmembrane protease, serine 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214523
Homologene: 80930
Kifc5b
Name: kinesin family member C5B
Synonyms: kinesin family c-terminal 5B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16580
VEGA: 17
HGNC: HGNC:6389
Homologene: 83229
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: b2b1554Clo, A2mr, CD91
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Efcab6
Name: EF-hand calcium binding domain 6
Synonyms: 4931407K02Rik, 4932408N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 77627
Homologene: 11259
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Birc1e, Naip-rs3, Lgn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Wdr93
Name: WD repeat domain 93
Synonyms: EG626359
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 626359
Homologene: 56878
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 105242472
Serpinb6e
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6e
Synonyms: SPI3B, Gm11396, ovalbumin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 435350
HGNC: HGNC:8950
Homologene: 50933
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227377
Homologene: 8877
Mre11a
Name: MRE11A homolog A, double strand break repair nuclease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17535
HGNC: HGNC:7230
Homologene: 4083
Mocs3
Name: molybdenum cofactor synthesis 3
Synonyms: 1700020H17Rik, Uba4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69372
Homologene: 6108
Caskin1
Name: CASK interacting protein 1
Synonyms: C630036E02Rik, 3300002N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268932
VEGA: 17
Homologene: 25873
Acss1
Name: acyl-CoA synthetase short-chain family member 1
Synonyms: AceCS2, 1110032O15Rik, Acas2l, Acas2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68738
Homologene: 56037
Or4c118
Name: olfactory receptor family 4 subfamily C member 118
Synonyms: MOR233-10, Olfr1223, GA_x6K02T2Q125-50623664-50622729
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258894
Homologene: 79379
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: MaxiK, BK channel alpha subunit, mSlo1, Slo, 5730414M22Rik, BKCa, Slo1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Prkch
Name: protein kinase C, eta
Synonyms: Pkch
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18755
HGNC: HGNC:9403
Homologene: 84384
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230806
Homologene: 19232
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 632671
Spp2
Name: secreted phosphoprotein 2
Synonyms: spp24, 0610038O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75396
Homologene: 5058
Krt84
Name: keratin 84
Synonyms: Krt2-3, HRb-1, Krt2-16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16680
VEGA: 15
HGNC: HGNC:6461
Homologene: 22473
Edar
Name: ectodysplasin-A receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13608
HGNC: HGNC:2895
Homologene: 7699
Ppp4r4
Name: protein phosphatase 4, regulatory subunit 4
Synonyms: 8430415E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74521
Homologene: 12571
Or1ak2
Name: olfactory receptor family 1 subfamily AK member 2
Synonyms: GA_x6K02T2NLDC-33631647-33632594, MOR134-1, Olfr356
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258617
Homologene: 85948
Tmprss11c
Name: transmembrane protease, serine 11c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 435845
Homologene: 78847
Tmx2
Name: thioredoxin-related transmembrane protein 2
Synonyms: Txndc14, 2310042M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66958
Homologene: 9317
Cdc20b
Name: cell division cycle 20B
Synonyms: EG238896, EG622422
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238896
Homologene: 65056
Pcgf6
Name: polycomb group ring finger 6
Synonyms: Mel18 and Bmi1-like RING finger protein, 4933407A11Rik, Rnf134, MBLR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71041
VEGA: 19
Homologene: 12378
Erbb2
Name: erb-b2 receptor tyrosine kinase 2
Synonyms: HER2, c-neu, Neu oncogene, ErbB-2, Neu, c-erbB2, HER-2, l11Jus8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13866
HGNC: HGNC:3430
Homologene: 3273
Kbtbd3
Name: kelch repeat and BTB (POZ) domain containing 3
Synonyms: Bklhd3, 2200003A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 69149
Homologene: 12300
Msln
Name: mesothelin
Synonyms: megakaryocyte potentiating factor, MPF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 56047
VEGA: 17
HGNC: HGNC:7371
Homologene: 4249
Myb
Name: myeloblastosis oncogene
Synonyms: c-myb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17863
HGNC: HGNC:7545
Homologene: 31311
Klhdc9
Name: kelch domain containing 9
Synonyms: 1190002J23Rik, ESTM31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68874
Homologene: 66637
Abhd12
Name: abhydrolase domain containing 12
Synonyms: 6330583M11Rik, 1500011G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76192
Homologene: 22910
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74691
Homologene: 14311
B9d1
Name: B9 protein domain 1
Synonyms: Eppb9, B9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 27078
Homologene: 8440
Fam98a
Name: family with sequence similarity 98, member A
Synonyms: 2810405J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72722
Homologene: 41042
Icam2
Name: intercellular adhesion molecule 2
Synonyms: CD102, Icam-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15896
HGNC: HGNC:5345
Homologene: 675
Itga7
Name: integrin alpha 7
Synonyms: alpha7, [a]7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16404
VEGA: 10
HGNC: HGNC:6143
Homologene: 37592
Gdf9
Name: growth differentiation factor 9
Synonyms: Gdf-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14566
HGNC: HGNC:4224
Homologene: 3851
Cd47
Name: CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Synonyms: B430305P08Rik, integrin-associated protein, Itgp, 9130415E20Rik, IAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16423
HGNC: HGNC:1682
Homologene: 1346
Or14c44
Name: olfactory receptor family 14 subfamily C member 44
Synonyms: GA_x6K02T2NHDJ-9695951-9695766, MOR221-4, MOR211-8P, Olfr1531-ps1, Olfr301, MOR221-1P, MOR221-1P, GA_x6K02T2NHDJ-9693313-9692378, Olfr302
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 257958
Homologene: 128067
Csf1r
Name: colony stimulating factor 1 receptor
Synonyms: M-CSFR, CSF-1R, Fim-2, Fms, Fim2, Csfmr, CD115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12978
HGNC: HGNC:2433
Homologene: 3817
Fcmr
Name: Fc fragment of IgM receptor
Synonyms: Faim3, 1810037B05Rik, FcmuR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69169
Homologene: 48347
Mrps7
Name: mitchondrial ribosomal protein S7
Synonyms: MRP-S7, Rpms7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 50529
Homologene: 9321
H2-M10.1
Name: histocompatibility 2, M region locus 10.1
Synonyms: 9.5H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14985
Homologene: 117973
Msantd5f1
Name: Myb/SANT DNA binding domain containing 5 family member 1
Synonyms: LOC242502, Gm428
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242502
Homologene: 128423
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 60,200,119 bp
  • T to C, chromosome 1 at 88,417,303 bp
  • T to C, chromosome 1 at 93,603,469 bp
  • A to G, chromosome 1 at 130,878,251 bp
  • C to A, chromosome 1 at 171,360,448 bp
  • T to G, chromosome 1 at 179,043,876 bp
  • T to C, chromosome 2 at 36,937,323 bp
  • A to T, chromosome 2 at 84,676,117 bp
  • A to C, chromosome 2 at 89,145,002 bp
  • A to T, chromosome 2 at 150,638,437 bp
  • T to A, chromosome 2 at 150,848,421 bp
  • A to G, chromosome 2 at 168,231,569 bp
  • A to G, chromosome 3 at 84,167,650 bp
  • A to C, chromosome 3 at 95,200,128 bp
  • A to G, chromosome 4 at 4,792,737 bp
  • A to T, chromosome 4 at 73,687,384 bp
  • C to A, chromosome 4 at 134,074,825 bp
  • A to G, chromosome 4 at 134,074,903 bp
  • T to A, chromosome 4 at 137,533,437 bp
  • T to A, chromosome 5 at 37,273,439 bp
  • G to A, chromosome 5 at 86,239,424 bp
  • A to T, chromosome 5 at 120,652,845 bp
  • A to G, chromosome 5 at 151,561,999 bp
  • A to G, chromosome 6 at 80,022,528 bp
  • A to G, chromosome 6 at 83,954,737 bp
  • A to G, chromosome 6 at 125,123,584 bp
  • G to A, chromosome 7 at 28,898,266 bp
  • T to C, chromosome 7 at 79,750,082 bp
  • A to G, chromosome 7 at 86,407,870 bp
  • T to C, chromosome 7 at 141,237,521 bp
  • C to A, chromosome 9 at 4,330,589 bp
  • T to C, chromosome 9 at 14,802,753 bp
  • A to G, chromosome 9 at 32,259,800 bp
  • A to T, chromosome 9 at 45,179,457 bp
  • A to G, chromosome 9 at 110,549,864 bp
  • A to G, chromosome 10 at 21,126,198 bp
  • A to G, chromosome 10 at 58,606,053 bp
  • A to G, chromosome 10 at 62,879,674 bp
  • A to G, chromosome 10 at 127,543,075 bp
  • C to T, chromosome 10 at 128,948,824 bp
  • G to A, chromosome 11 at 53,433,749 bp
  • A to G, chromosome 11 at 61,512,449 bp
  • G to A, chromosome 11 at 98,433,457 bp
  • A to G, chromosome 11 at 104,720,666 bp
  • C to T, chromosome 11 at 106,377,956 bp
  • G to T, chromosome 11 at 115,604,755 bp
  • C to T, chromosome 12 at 28,691,777 bp
  • A to T, chromosome 12 at 44,576,679 bp
  • A to G, chromosome 12 at 73,759,001 bp
  • A to G, chromosome 12 at 103,584,072 bp
  • T to C, chromosome 12 at 104,708,805 bp
  • C to A, chromosome 12 at 112,024,706 bp
  • T to C, chromosome 13 at 33,836,423 bp
  • T to C, chromosome 13 at 81,487,853 bp
  • T to C, chromosome 13 at 99,432,583 bp
  • T to C, chromosome 13 at 100,221,911 bp
  • T to A, chromosome 13 at 113,078,724 bp
  • T to A, chromosome 14 at 23,314,194 bp
  • G to A, chromosome 14 at 64,030,993 bp
  • C to A, chromosome 15 at 25,742,369 bp
  • A to G, chromosome 15 at 83,870,993 bp
  • G to A, chromosome 15 at 101,525,963 bp
  • T to C, chromosome 16 at 49,894,228 bp
  • C to T, chromosome 17 at 24,502,212 bp
  • T to C, chromosome 17 at 25,753,408 bp
  • T to C, chromosome 17 at 26,925,530 bp
  • A to G, chromosome 17 at 36,325,756 bp
  • A to G, chromosome 17 at 75,547,715 bp
  • AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC, chromosome 18 at 42,301,883 bp
  • T to A, chromosome 18 at 61,110,401 bp
  • T to A, chromosome 18 at 63,720,776 bp
  • A to T, chromosome 19 at 47,049,002 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1651 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039687-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.