Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1651Btlr/Mmmh
Stock Number:
039687-MU
Citation ID:
RRID:MMRRC_039687-MU
Other Names:
R1651 (G1), C57BL/6J-MtgxR1651Btlr
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 60,200,119 bp
  • T to C, chromosome 1 at 88,417,303 bp
  • T to C, chromosome 1 at 93,603,469 bp
  • A to G, chromosome 1 at 130,878,251 bp
  • C to A, chromosome 1 at 171,360,448 bp
  • T to G, chromosome 1 at 179,043,876 bp
  • T to C, chromosome 2 at 36,937,323 bp
  • A to T, chromosome 2 at 84,676,117 bp
  • A to C, chromosome 2 at 89,145,002 bp
  • A to T, chromosome 2 at 150,638,437 bp
  • T to A, chromosome 2 at 150,848,421 bp
  • A to G, chromosome 2 at 168,231,569 bp
  • A to G, chromosome 3 at 84,167,650 bp
  • A to C, chromosome 3 at 95,200,128 bp
  • A to G, chromosome 4 at 4,792,737 bp
  • A to T, chromosome 4 at 73,687,384 bp
  • C to A, chromosome 4 at 134,074,825 bp
  • A to G, chromosome 4 at 134,074,903 bp
  • T to A, chromosome 4 at 137,533,437 bp
  • T to A, chromosome 5 at 37,273,439 bp
  • G to A, chromosome 5 at 86,239,424 bp
  • A to T, chromosome 5 at 120,652,845 bp
  • A to G, chromosome 5 at 151,561,999 bp
  • A to G, chromosome 6 at 80,022,528 bp
  • A to G, chromosome 6 at 83,954,737 bp
  • A to G, chromosome 6 at 125,123,584 bp
  • G to A, chromosome 7 at 28,898,266 bp
  • T to C, chromosome 7 at 79,750,082 bp
  • A to G, chromosome 7 at 86,407,870 bp
  • T to C, chromosome 7 at 141,237,521 bp
  • C to A, chromosome 9 at 4,330,589 bp
  • T to C, chromosome 9 at 14,802,753 bp
  • A to G, chromosome 9 at 32,259,800 bp
  • A to T, chromosome 9 at 45,179,457 bp
  • A to G, chromosome 9 at 110,549,864 bp
  • A to G, chromosome 10 at 21,126,198 bp
  • A to G, chromosome 10 at 58,606,053 bp
  • A to G, chromosome 10 at 62,879,674 bp
  • A to G, chromosome 10 at 127,543,075 bp
  • C to T, chromosome 10 at 128,948,824 bp
  • G to A, chromosome 11 at 53,433,749 bp
  • A to G, chromosome 11 at 61,512,449 bp
  • G to A, chromosome 11 at 98,433,457 bp
  • A to G, chromosome 11 at 104,720,666 bp
  • C to T, chromosome 11 at 106,377,956 bp
  • G to T, chromosome 11 at 115,604,755 bp
  • C to T, chromosome 12 at 28,691,777 bp
  • A to T, chromosome 12 at 44,576,679 bp
  • A to G, chromosome 12 at 73,759,001 bp
  • A to G, chromosome 12 at 103,584,072 bp
  • T to C, chromosome 12 at 104,708,805 bp
  • C to A, chromosome 12 at 112,024,706 bp
  • T to C, chromosome 13 at 33,836,423 bp
  • T to C, chromosome 13 at 81,487,853 bp
  • T to C, chromosome 13 at 99,432,583 bp
  • T to C, chromosome 13 at 100,221,911 bp
  • T to A, chromosome 13 at 113,078,724 bp
  • T to A, chromosome 14 at 23,314,194 bp
  • G to A, chromosome 14 at 64,030,993 bp
  • C to A, chromosome 15 at 25,742,369 bp
  • A to G, chromosome 15 at 83,870,993 bp
  • G to A, chromosome 15 at 101,525,963 bp
  • T to C, chromosome 16 at 49,894,228 bp
  • C to T, chromosome 17 at 24,502,212 bp
  • T to C, chromosome 17 at 25,753,408 bp
  • T to C, chromosome 17 at 26,925,530 bp
  • A to G, chromosome 17 at 36,325,756 bp
  • A to G, chromosome 17 at 75,547,715 bp
  • AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC, chromosome 18 at 42,301,883 bp
  • T to A, chromosome 18 at 61,110,401 bp
  • T to A, chromosome 18 at 63,720,776 bp
  • A to T, chromosome 19 at 47,049,002 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1651 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039687-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.