Strain Detail Sheet
- T to A, chromosome 1 at 60,200,119 bp
- T to C, chromosome 1 at 88,417,303 bp
- T to C, chromosome 1 at 93,603,469 bp
- A to G, chromosome 1 at 130,878,251 bp
- C to A, chromosome 1 at 171,360,448 bp
- T to G, chromosome 1 at 179,043,876 bp
- T to C, chromosome 2 at 36,937,323 bp
- A to T, chromosome 2 at 84,676,117 bp
- A to C, chromosome 2 at 89,145,002 bp
- A to T, chromosome 2 at 150,638,437 bp
- T to A, chromosome 2 at 150,848,421 bp
- A to G, chromosome 2 at 168,231,569 bp
- A to G, chromosome 3 at 84,167,650 bp
- A to C, chromosome 3 at 95,200,128 bp
- A to G, chromosome 4 at 4,792,737 bp
- A to T, chromosome 4 at 73,687,384 bp
- C to A, chromosome 4 at 134,074,825 bp
- A to G, chromosome 4 at 134,074,903 bp
- T to A, chromosome 4 at 137,533,437 bp
- T to A, chromosome 5 at 37,273,439 bp
- G to A, chromosome 5 at 86,239,424 bp
- A to T, chromosome 5 at 120,652,845 bp
- A to G, chromosome 5 at 151,561,999 bp
- A to G, chromosome 6 at 80,022,528 bp
- A to G, chromosome 6 at 83,954,737 bp
- A to G, chromosome 6 at 125,123,584 bp
- G to A, chromosome 7 at 28,898,266 bp
- T to C, chromosome 7 at 79,750,082 bp
- A to G, chromosome 7 at 86,407,870 bp
- T to C, chromosome 7 at 141,237,521 bp
- C to A, chromosome 9 at 4,330,589 bp
- T to C, chromosome 9 at 14,802,753 bp
- A to G, chromosome 9 at 32,259,800 bp
- A to T, chromosome 9 at 45,179,457 bp
- A to G, chromosome 9 at 110,549,864 bp
- A to G, chromosome 10 at 21,126,198 bp
- A to G, chromosome 10 at 58,606,053 bp
- A to G, chromosome 10 at 62,879,674 bp
- A to G, chromosome 10 at 127,543,075 bp
- C to T, chromosome 10 at 128,948,824 bp
- G to A, chromosome 11 at 53,433,749 bp
- A to G, chromosome 11 at 61,512,449 bp
- G to A, chromosome 11 at 98,433,457 bp
- A to G, chromosome 11 at 104,720,666 bp
- C to T, chromosome 11 at 106,377,956 bp
- G to T, chromosome 11 at 115,604,755 bp
- C to T, chromosome 12 at 28,691,777 bp
- A to T, chromosome 12 at 44,576,679 bp
- A to G, chromosome 12 at 73,759,001 bp
- A to G, chromosome 12 at 103,584,072 bp
- T to C, chromosome 12 at 104,708,805 bp
- C to A, chromosome 12 at 112,024,706 bp
- T to C, chromosome 13 at 33,836,423 bp
- T to C, chromosome 13 at 81,487,853 bp
- T to C, chromosome 13 at 99,432,583 bp
- T to C, chromosome 13 at 100,221,911 bp
- T to A, chromosome 13 at 113,078,724 bp
- T to A, chromosome 14 at 23,314,194 bp
- G to A, chromosome 14 at 64,030,993 bp
- C to A, chromosome 15 at 25,742,369 bp
- A to G, chromosome 15 at 83,870,993 bp
- G to A, chromosome 15 at 101,525,963 bp
- T to C, chromosome 16 at 49,894,228 bp
- C to T, chromosome 17 at 24,502,212 bp
- T to C, chromosome 17 at 25,753,408 bp
- T to C, chromosome 17 at 26,925,530 bp
- A to G, chromosome 17 at 36,325,756 bp
- A to G, chromosome 17 at 75,547,715 bp
- AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC, chromosome 18 at 42,301,883 bp
- T to A, chromosome 18 at 61,110,401 bp
- T to A, chromosome 18 at 63,720,776 bp
- A to T, chromosome 19 at 47,049,002 bp
- Genotyping Protocol(s)
- Center protocol and contact for technical support will be shipped with mice.
Colony Surveillance Program and Current Health Reports
Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
| MMRRC Item # | Description | Distribution Fee / Unit (US $) | Units | Notes |
|---|---|---|---|---|
| 039687-MU-RESUS | Litter recovered from cryo-archive | $5,475.00 / Non-Profit | Litter | Recovered litter1; additional fees for any special requests. |
| Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information. | ||||
Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.
1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.