Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1660Btlr/Mmmh
Stock Number:
039696-MU
Citation ID:
RRID:MMRRC_039696-MU
Other Names:
R1660 (G1), C57BL/6J-MtgxR1660Btlr
Major Collection:

Strain Information

Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Chrm1
Name: cholinergic receptor, muscarinic 1, CNS
Synonyms: M1, muscarinic acetylcholine receptor 1, Chrm-1, M1R, AW495047
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12669
HGNC: HGNC:1950
Homologene: 20189
Pias2
Name: protein inhibitor of activated STAT 2
Synonyms: Dib, 6330408K17Rik, ARIP3, PIASxbeta, PIASxalpha, PIASxb, Miz1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17344
VEGA: 18
Homologene: 20979
Poli
Name: polymerase (DNA directed), iota
Synonyms: Rad30b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26447
HGNC: HGNC:9182
Homologene: 5209
Vpreb3
Name: V-set pre-B cell surrogate light chain 3
Synonyms: Vpreb-3, 8HS-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22364
Homologene: 7598
Fkbp9
Name: FK506 binding protein 9
Synonyms: FKBP60, FKBP63
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27055
HGNC: HGNC:3725
Homologene: 31434
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 75,215,903 bp
  • T to A, chromosome 1 at 107,271,702 bp
  • A to G, chromosome 1 at 130,705,510 bp
  • A to G, chromosome 1 at 170,514,637 bp
  • T to A, chromosome 1 at 172,066,772 bp
  • T to C, chromosome 1 at 177,447,763 bp
  • A to T, chromosome 1 at 183,087,742 bp
  • T to C, chromosome 1 at 183,297,583 bp
  • T to C, chromosome 1 at 188,916,064 bp
  • A to G, chromosome 1 at 193,320,560 bp
  • G to A, chromosome 2 at 25,503,274 bp
  • C to A, chromosome 2 at 91,562,958 bp
  • A to T, chromosome 2 at 120,018,548 bp
  • G to A, chromosome 2 at 151,594,478 bp
  • T to C, chromosome 3 at 59,331,285 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • A to T, chromosome 3 at 138,103,193 bp
  • G to A, chromosome 4 at 15,971,771 bp
  • A to T, chromosome 4 at 149,719,575 bp
  • T to C, chromosome 4 at 151,992,505 bp
  • A to T, chromosome 4 at 155,792,071 bp
  • T to C, chromosome 5 at 35,519,066 bp
  • T to A, chromosome 5 at 87,139,618 bp
  • A to T, chromosome 5 at 97,975,350 bp
  • T to G, chromosome 5 at 109,053,858 bp
  • T to C, chromosome 5 at 120,549,515 bp
  • T to A, chromosome 6 at 5,289,006 bp
  • C to A, chromosome 6 at 54,944,233 bp
  • T to C, chromosome 6 at 56,873,449 bp
  • T to A, chromosome 6 at 106,679,297 bp
  • A to G, chromosome 7 at 7,181,790 bp
  • G to A, chromosome 7 at 26,809,682 bp
  • A to C, chromosome 7 at 35,729,786 bp
  • T to A, chromosome 7 at 66,069,498 bp
  • T to C, chromosome 7 at 101,913,438 bp
  • T to G, chromosome 7 at 102,877,656 bp
  • T to A, chromosome 7 at 103,603,675 bp
  • T to C, chromosome 7 at 127,796,669 bp
  • A to T, chromosome 8 at 36,140,023 bp
  • A to G, chromosome 8 at 105,293,060 bp
  • A to T, chromosome 9 at 37,429,144 bp
  • A to T, chromosome 9 at 54,451,030 bp
  • T to A, chromosome 9 at 66,271,615 bp
  • T to C, chromosome 9 at 110,862,489 bp
  • A to T, chromosome 9 at 123,185,362 bp
  • C to A, chromosome 10 at 5,348,535 bp
  • C to A, chromosome 10 at 49,244,343 bp
  • A to G, chromosome 10 at 75,948,412 bp
  • A to T, chromosome 11 at 17,227,183 bp
  • A to G, chromosome 11 at 70,463,502 bp
  • C to T, chromosome 11 at 70,728,397 bp
  • T to A, chromosome 12 at 29,895,273 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • C to T, chromosome 12 at 83,668,150 bp
  • T to C, chromosome 13 at 56,176,435 bp
  • A to G, chromosome 13 at 80,891,645 bp
  • C to T, chromosome 13 at 81,476,631 bp
  • T to C, chromosome 13 at 94,408,812 bp
  • T to C, chromosome 13 at 97,981,376 bp
  • T to C, chromosome 13 at 105,270,991 bp
  • C to A, chromosome 14 at 51,456,236 bp
  • A to G, chromosome 14 at 55,650,572 bp
  • A to G, chromosome 14 at 56,370,848 bp
  • T to A, chromosome 14 at 61,209,009 bp
  • A to G, chromosome 14 at 115,399,279 bp
  • A to C, chromosome 15 at 9,125,114 bp
  • A to C, chromosome 15 at 9,717,440 bp
  • C to A, chromosome 15 at 99,305,561 bp
  • T to A, chromosome 16 at 59,086,343 bp
  • A to T, chromosome 17 at 18,597,726 bp
  • C to T, chromosome 17 at 80,245,728 bp
  • T to C, chromosome 18 at 68,276,096 bp
  • A to G, chromosome 18 at 70,509,464 bp
  • A to G, chromosome 18 at 77,120,129 bp
  • T to C, chromosome 19 at 7,268,972 bp
  • T to C, chromosome 19 at 8,679,218 bp
  • T to A, chromosome 19 at 12,953,691 bp
  • C to A, chromosome 19 at 31,893,107 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1660 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039696-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.