Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1660Btlr/Mmmh
Stock Number:
039696-MU
Citation ID:
RRID:MMRRC_039696-MU
Other Names:
R1660 (G1), C57BL/6J-MtgxR1660Btlr
Major Collection:

Strain Information

Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Chrm1
Name: cholinergic receptor, muscarinic 1, CNS
Synonyms: M1, muscarinic acetylcholine receptor 1, Chrm-1, M1R, AW495047
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12669
HGNC: HGNC:1950
Homologene: 20189
Pias2
Name: protein inhibitor of activated STAT 2
Synonyms: Dib, 6330408K17Rik, ARIP3, PIASxbeta, PIASxalpha, PIASxb, Miz1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17344
VEGA: 18
Homologene: 20979
Poli
Name: polymerase (DNA directed), iota
Synonyms: Rad30b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26447
HGNC: HGNC:9182
Homologene: 5209
Vpreb3
Name: V-set pre-B cell surrogate light chain 3
Synonyms: Vpreb-3, 8HS-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22364
Homologene: 7598
Fkbp9
Name: FK506 binding protein 9
Synonyms: FKBP60, FKBP63
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27055
HGNC: HGNC:3725
Homologene: 31434
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Rbm25
Name: RNA binding motif protein 25
Synonyms: 2610015J01Rik, A130095G20Rik, 2600011C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67039
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: rim2, recombination induced mutation 2, Hps2, beta3A, AP-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Skp2
Name: S-phase kinase-associated protein 2
Synonyms: FBXL1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27401
Homologene: 55942
Arrdc3
Name: arrestin domain containing 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105171
Homologene: 69318
Nbn
Name: nibrin
Synonyms: Nbs1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27354
HGNC: HGNC:7652
Homologene: 1858
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233904
Homologene: 52251
Zbtb18
Name: zinc finger and BTB domain containing 18
Synonyms: RP58, Zfp238
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30928
Homologene: 21276
Cdcp1
Name: CUB domain containing protein 1
Synonyms: 9030022E12Rik, E030027H19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109332
Homologene: 11276
Pon2
Name: paraoxonase 2
Synonyms: 6330405I24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330260
HGNC: HGNC:9205
Homologene: 385
Tmem201
Name: transmembrane protein 201
Synonyms: D4Ertd429e, Samp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230917
Homologene: 35319
Ncstn
Name: nicastrin
Synonyms: nicastrin, 9430068N19Rik, Nct, D1Dau13e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59287
Homologene: 41029
Dnaaf10
Name: dynein axonemal assembly factor 10
Synonyms: Wdr92
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103784
Homologene: 16321
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Phf13
Name: PHD finger protein 13
Synonyms: SPOC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230936
Homologene: 17822
Atp12a
Name: ATPase, H+/K+ transporting, nongastric, alpha polypeptide
Synonyms: HKalpha2, cHKA, Atp1al1, ATPase H+K+-transporting, alpha 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192113
VEGA: 14
Homologene: 68197
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Lrrc51
Name: leucine rich repeat containing 51
Synonyms: 1700008D07Rik, Lrtomt
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69358
Homologene: 17066
Dhx57
Name: DExH-box helicase 57
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Zfp418
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232854
Homologene: 119890
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: MTP, 1810043K16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Or51f2
Name: olfactory receptor family 51 subfamily F member 2
Synonyms: GA_x6K02T2PBJ9-5588278-5589228, MOR14-3, MOR14-11, Olfr568
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259095
Homologene: 81595
AC159748.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Antxr2
Name: anthrax toxin receptor 2
Synonyms: cI-35, CMG-2, CMG2, 2310046B19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71914
Homologene: 43236
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Ankrd65
Name: ankyrin repeat domain 65
Synonyms: E230028L10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242805
Homologene: 28427
Exoc3l
Name: exocyst complex component 3-like
Synonyms: C730015A04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277978
Homologene: 18629
Myt1l
Name: myelin transcription factor 1-like
Synonyms: Png-1, Nztf1, Pmng1, C630034G21Rik, 2900093J19Rik, 2900046C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17933
VEGA: 12
HGNC: HGNC:7623
Homologene: 7435
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Tifab
Name: TRAF-interacting protein with forkhead-associated domain, family member B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212937
VEGA: 13
Homologene: 27087
Pfkfb2
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms: PFK-2/FBPase-2 gene B, 4930568D07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18640
HGNC: HGNC:8873
Homologene: 88554
Cntn4
Name: contactin 4
Synonyms: BIG-2A, Axcam
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269784
HGNC: HGNC:2174
Homologene: 14257
Zmynd15
Name: zinc finger, MYND-type containing 15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 574428
Homologene: 12995
Nod1
Name: nucleotide-binding oligomerization domain containing 1
Synonyms: F830007N14Rik, Card4, Nlrc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107607
Homologene: 4440
Nos1ap
Name: nitric oxide synthase 1 (neuronal) adaptor protein
Synonyms: 6330408P19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70729
Homologene: 135990
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Prpf40b
Name: pre-mRNA processing factor 40B
Synonyms: 2610317D23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54614
Homologene: 81828
Cyp2g1
Name: cytochrome P450, family 2, subfamily g, polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13108
HGNC: HGNC:2633
Homologene: 75020
Or5b98
Name: olfactory receptor family 5 subfamily B member 98
Synonyms: GA_x6K02T2RE5P-3283121-3284098, MOR202-33, Olfr1450
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258368
Vmn2r89
Name: vomeronasal 2, receptor 89
Synonyms: V2r11, V2r10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22301
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: Jnkbp1, 2810483F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Dpy19l3
Name: dpy-19 like C-mannosyltransferase 3
Synonyms: 9330164H19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233115
Homologene: 18692
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Tssk4
Name: testis-specific serine kinase 4
Synonyms: 1700020B19Rik, 4933424F08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71099
VEGA: 14
Homologene: 57078
Serpinb3c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms: 1110001H02Rik, 1110013A16Rik, ovalbumin, Serpinb4, Scca2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381286
Homologene: 131278
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Or5h23
Name: olfactory receptor family 5 subfamily H member 23
Synonyms: GA_x54KRFPKG5P-55314632-55313703, MOR183-5P, Olfr191
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258035
Homologene: 128162
Rnf180
Name: ring finger protein 180
Synonyms: 3110001E11Rik, Rines
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71816
VEGA: 13
Homologene: 18677
A1cf
Name: APOBEC1 complementation factor
Synonyms: ACF, apobec-1 complementation factor, 1810073H04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69865
VEGA: 19
Homologene: 16363
Vmn2r96
Name: vomeronasal 2, receptor 96
Synonyms: EG433070
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433070
Gpc5
Name: glypican 5
Synonyms: A230034F01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 103978
HGNC: HGNC:4453
Homologene: 3285
Prag1
Name: PEAK1 related kinase activating pseudokinase 1
Synonyms: NACK, D8Ertd82e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244418
Homologene: 18256
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glur-6, Glur6, Glurbeta2, C130030K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Cpz
Name: carboxypeptidase Z
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242939
HGNC: HGNC:2333
Homologene: 2709
Prss50
Name: serine protease 50
Synonyms: Tsp50
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235631
Homologene: 8314
Dapk2
Name: death-associated protein kinase 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13143
HGNC: HGNC:2675
Homologene: 74940
Ugt2b5
Name: UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms: Udpgt-3, m-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22238
Homologene: 137225
Fbxw5
Name: F-box and WD-40 domain protein 5
Synonyms: Fbw5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30839
Homologene: 8496
Tuba4a
Name: tubulin, alpha 4A
Synonyms: M[a]4, Tuba4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22145
Homologene: 68496
Kif1c
Name: kinesin family member 1C
Synonyms: N-3 kinsin, D11Bwg1349e, B430105J22Rik, Orch3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16562
HGNC: HGNC:6317
Homologene: 4821
Snrpa1
Name: small nuclear ribonucleoprotein polypeptide A'
Synonyms: U2 snRNP-A', 1500015N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68981
Homologene: 2325
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Or52z14
Name: olfactory receptor family 52 subfamily Z member 14
Synonyms: GA_x6K02T2PBJ9-6326488-6327450, MOR31-5, Olfr619
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259080
Homologene: 45095
Rcor2
Name: REST corepressor 2
Synonyms: CoREST, 1A13
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104383
Homologene: 14280
Aida
Name: axin interactor, dorsalization associated
Synonyms: 2610208M17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108909
Homologene: 11268
Fam210a
Name: family with sequence similarity 210, member A
Synonyms: 4933403F05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108654
Homologene: 34981
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 75,215,903 bp
  • T to A, chromosome 1 at 107,271,702 bp
  • A to G, chromosome 1 at 130,705,510 bp
  • A to G, chromosome 1 at 170,514,637 bp
  • T to A, chromosome 1 at 172,066,772 bp
  • T to C, chromosome 1 at 177,447,763 bp
  • A to T, chromosome 1 at 183,087,742 bp
  • T to C, chromosome 1 at 183,297,583 bp
  • T to C, chromosome 1 at 188,916,064 bp
  • A to G, chromosome 1 at 193,320,560 bp
  • G to A, chromosome 2 at 25,503,274 bp
  • C to A, chromosome 2 at 91,562,958 bp
  • A to T, chromosome 2 at 120,018,548 bp
  • G to A, chromosome 2 at 151,594,478 bp
  • T to C, chromosome 3 at 59,331,285 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • A to T, chromosome 3 at 138,103,193 bp
  • G to A, chromosome 4 at 15,971,771 bp
  • A to T, chromosome 4 at 149,719,575 bp
  • T to C, chromosome 4 at 151,992,505 bp
  • A to T, chromosome 4 at 155,792,071 bp
  • T to C, chromosome 5 at 35,519,066 bp
  • T to A, chromosome 5 at 87,139,618 bp
  • A to T, chromosome 5 at 97,975,350 bp
  • T to G, chromosome 5 at 109,053,858 bp
  • T to C, chromosome 5 at 120,549,515 bp
  • T to A, chromosome 6 at 5,289,006 bp
  • C to A, chromosome 6 at 54,944,233 bp
  • T to C, chromosome 6 at 56,873,449 bp
  • T to A, chromosome 6 at 106,679,297 bp
  • A to G, chromosome 7 at 7,181,790 bp
  • G to A, chromosome 7 at 26,809,682 bp
  • A to C, chromosome 7 at 35,729,786 bp
  • T to A, chromosome 7 at 66,069,498 bp
  • T to C, chromosome 7 at 101,913,438 bp
  • T to G, chromosome 7 at 102,877,656 bp
  • T to A, chromosome 7 at 103,603,675 bp
  • T to C, chromosome 7 at 127,796,669 bp
  • A to T, chromosome 8 at 36,140,023 bp
  • A to G, chromosome 8 at 105,293,060 bp
  • A to T, chromosome 9 at 37,429,144 bp
  • A to T, chromosome 9 at 54,451,030 bp
  • T to A, chromosome 9 at 66,271,615 bp
  • T to C, chromosome 9 at 110,862,489 bp
  • A to T, chromosome 9 at 123,185,362 bp
  • C to A, chromosome 10 at 5,348,535 bp
  • C to A, chromosome 10 at 49,244,343 bp
  • A to G, chromosome 10 at 75,948,412 bp
  • A to T, chromosome 11 at 17,227,183 bp
  • A to G, chromosome 11 at 70,463,502 bp
  • C to T, chromosome 11 at 70,728,397 bp
  • T to A, chromosome 12 at 29,895,273 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • C to T, chromosome 12 at 83,668,150 bp
  • T to C, chromosome 13 at 56,176,435 bp
  • A to G, chromosome 13 at 80,891,645 bp
  • C to T, chromosome 13 at 81,476,631 bp
  • T to C, chromosome 13 at 94,408,812 bp
  • T to C, chromosome 13 at 97,981,376 bp
  • T to C, chromosome 13 at 105,270,991 bp
  • C to A, chromosome 14 at 51,456,236 bp
  • A to G, chromosome 14 at 55,650,572 bp
  • A to G, chromosome 14 at 56,370,848 bp
  • T to A, chromosome 14 at 61,209,009 bp
  • A to G, chromosome 14 at 115,399,279 bp
  • A to C, chromosome 15 at 9,125,114 bp
  • A to C, chromosome 15 at 9,717,440 bp
  • C to A, chromosome 15 at 99,305,561 bp
  • T to A, chromosome 16 at 59,086,343 bp
  • A to T, chromosome 17 at 18,597,726 bp
  • C to T, chromosome 17 at 80,245,728 bp
  • T to C, chromosome 18 at 68,276,096 bp
  • A to G, chromosome 18 at 70,509,464 bp
  • A to G, chromosome 18 at 77,120,129 bp
  • T to C, chromosome 19 at 7,268,972 bp
  • T to C, chromosome 19 at 8,679,218 bp
  • T to A, chromosome 19 at 12,953,691 bp
  • C to A, chromosome 19 at 31,893,107 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1660 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039696-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.