Strain Name:
C57BL/6J-MtgxR1661Btlr/Mmmh
Stock Number:
039697-MU
Citation ID:
RRID:MMRRC_039697-MU
Other Names:
R1661 (G1), C57BL/6J-MtgxR1661Btlr
Major Collection:

Strain Information

Htr4
Name: 5 hydroxytryptamine (serotonin) receptor 4
Synonyms: 5-HT4L, 5-HT4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 15562
VEGA: 18
HGNC: HGNC:5299
Homologene: 20243
Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: 5730557L09Rik, roquin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381305
Homologene: 19036
Pkp4
Name: plakophilin 4
Synonyms: p0071, 5031422I09Rik, 9430019K17Rik, Armrp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Mfn1
Name: mitofusin 1
Synonyms: 6330416C07Rik, D3Ertd265e, 2310002F04Rik, HR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67414
Homologene: 11481
Lrig3
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9430095K15Rik, 9030421L11Rik, 9130004I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Map1b
Name: microtubule-associated protein 1B
Synonyms: Mtap-5, Mtap5, Mtap1b, LC1, MAP5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Timmdc1
Name: translocase of inner mitochondrial membrane domain containing 1
Synonyms: 2810021C21Rik, 4930455C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 76916
HGNC: HGNC:1321
Homologene: 9578
Kif20a
Name: kinesin family member 20A
Synonyms: Rab6kifl, Rabkinesin-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Med13l
Name: mediator complex subunit 13-like
Synonyms: Trap240L, Thrap2, 9030618F05Rik, 2210413I17Rik, 6330591G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76199
Homologene: 25256
Nfkb1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: NF-kappaB p50, NF kappaB1, p50 subunit of NF kappaB, nuclear factor kappaB p50, p50/p105, p50, NF-kappaB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18033
HGNC: HGNC:7794
Homologene: 2971
Wdr59
Name: WD repeat domain 59
Synonyms: 5430401O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 319481
Homologene: 38685
Smc3
Name: structural maintenance of chromosomes 3
Synonyms: Cspg6, Bamacan, Mmip1, SmcD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13006
HGNC: HGNC:2468
Homologene: 3974
Appbp2
Name: amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Synonyms: PAT1, 1300003O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66884
HGNC: HGNC:622
Homologene: 31378
Smad1
Name: SMAD family member 1
Synonyms: Madr1, Madh1, Smad 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17125
HGNC: HGNC:6767
Homologene: 21196
Hsd17b4
Name: hydroxysteroid (17-beta) dehydrogenase 4
Synonyms: MFE-2, multifunctional protein 2, D-bifunctional protein, Mfp-2, perMFE-2, MFP2, 17[b]-HSD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 15488
HGNC: HGNC:5213
Homologene: 358
Kpna6
Name: karyopherin subunit alpha 6
Synonyms: IPOA7, importin alpha 7, NPI-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16650
HGNC: HGNC:6399
Homologene: 22472
Psmd12
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms: 1500002F15Rik, P55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66997
HGNC: HGNC:9557
Homologene: 2109
Caml
Name: calcium modulating ligand
Synonyms: Caml
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 12328
HGNC: HGNC:1471
Homologene: 1323
Fam222b
Name: family with sequence similarity 222, member B
Synonyms: BC017647
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216971
Homologene: 10054
Rttn
Name: rotatin
Synonyms: C530033I08Rik, 4921538A15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: Swl, MAP1C, Dnec1, Loa, dynein heavy chain, retrograde transport, Dnchc1, 9930018I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Ddb1
Name: damage specific DNA binding protein 1
Synonyms: p127-Ddb1, damage-specific DNA-binding protein, DNA repair, DNA repair protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13194
VEGA: 19
HGNC: HGNC:2717
Homologene: 1448
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: Itpr-1, opt, wblo, InsP3R type I, P400, Ip3r, Pcp1, Pcp-1, IP3R1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Txnrd3
Name: thioredoxin reductase 3
Synonyms: TR2, Tgr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232223
Homologene: 60033
Tmem126b
Name: transmembrane protein 126B
Synonyms: 1110001A23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68472
Homologene: 10222
Angel2
Name: angel homolog 2
Synonyms: D1Ertd396e, 5730410O10Rik, D1Ertd654e, 2610307I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 52477
Homologene: 16932
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: Fam208b, BC016423
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Fbxo32
Name: F-box protein 32
Synonyms: atrogin-1, 4833442G10Rik, ATROGIN1, MAFbx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 67731
VEGA: 15
Homologene: 12182
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Gnb4
Name: guanine nucleotide binding protein (G protein), beta 4
Synonyms: 6720453A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14696
Homologene: 69140
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Snx26, NOMA-GAP, Tcgap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233071
Homologene: 76448
Lclat1
Name: lysocardiolipin acyltransferase 1
Synonyms: Lycat, AGPAT8, ALCAT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 225010
Homologene: 33167
Muc15
Name: mucin 15
Synonyms: D730046L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269328
Homologene: 51680
Ighmbp2
Name: immunoglobulin mu DNA binding protein 2
Synonyms: Smubp2, Smbp-2, RIPE3b1, p110 subunit, AEP, sma, Smbp2, Catf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20589
HGNC: HGNC:5542
Homologene: 1642
Tax1bp1
Name: Tax1 (human T cell leukemia virus type I) binding protein 1
Synonyms: T6BP, 1700069J21Rik, D6Ertd772e, D6Ertd404e, 1200003J11Rik, TXBP151
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52440
Homologene: 4395
Saal1
Name: serum amyloid A-like 1
Synonyms: 5031425D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78935
Homologene: 34706
Amotl2
Name: angiomotin-like 2
Synonyms: Lccp, MASCOT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56332
Homologene: 9420
Nrde2
Name: nrde-2 necessary for RNA interference, domain containing
Synonyms: 6720454P05Rik, BC002230
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217827
VEGA: 12
Homologene: 41213
Slitrk1
Name: SLIT and NTRK-like family, member 1
Synonyms: 3200001I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 76965
VEGA: 14
Homologene: 14174
Wnt5a
Name: wingless-type MMTV integration site family, member 5A
Synonyms: 8030457G12Rik, Wnt-5a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 22418
Homologene: 20720
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, skrr, Ryr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20190
Homologene: 68069
F7
Name: coagulation factor VII
Synonyms: Cf7, FVII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14068
HGNC: HGNC:3544
Homologene: 7710
Abca3
Name: ATP-binding cassette, sub-family A (ABC1), member 3
Synonyms: 1810036E22Rik, ABC-C, Abc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Smarcd1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Synonyms: Baf60a, D15Kz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 83797
VEGA: 15
Homologene: 20670
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Ccdc125
Name: coiled-coil domain containing 125
Synonyms: 5830436D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 76041
VEGA: 13
Homologene: 27932
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Pde10a
Name: phosphodiesterase 10A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 23984
HGNC: HGNC:8772
Homologene: 4852
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: b2b585Clo, SPC6, b2b1549Clo, PC6, PC5/6A, PC5A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Ces2a
Name: carboxylesterase 2A
Synonyms: Ces6, 9130231C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102022
HGNC: HGNC:1864
Homologene: 136396
Ppp6r2
Name: protein phosphatase 6, regulatory subunit 2
Synonyms: 8430411H09Rik, Saps2, Pp6r2, 1110033O10Rik, B230107H12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 71474
VEGA: 15
Homologene: 36455
1700022I11Rik
Name: RIKEN cDNA 1700022I11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67317
Homologene: 52406
Sh3pxd2a
Name: SH3 and PX domains 2A
Synonyms: Sh3md1, 2310014D11Rik, Tks5, Fish
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14218
VEGA: 19
Homologene: 7317
Adamts9
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms: UND3, E030027K14Rik, 8430403M15Rik, Mhdaund4, UND4, Gsfund3, Mhdaund3, 1810011L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101401
Homologene: 18821
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231470
Homologene: 23516
Or4k39
Name: olfactory receptor family 4 subfamily K member 39, pseudogene 1
Synonyms: GA_x6K02T2Q125-72459956-72460837, MOR248-25_p, MOR248-17P, Olfr1285
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545447
Fem1b
Name: fem 1 homolog b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 14155
VEGA: 9
HGNC: HGNC:3649
Homologene: 7714
Zfp53
Name: zinc finger protein 53
Synonyms: KRAZ1, zfas8, Zfp118, D030067O06Rik, Zfp-53
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 24132
VEGA: 17
Homologene: 135946
Or10a2
Name: olfactory receptor family 10 subfamily A member 2
Synonyms: GA_x6K02T2PBJ9-9453401-9454354, Olfr714, P4, MOR263-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259035
Homologene: 72055
Cog2
Name: component of oligomeric golgi complex 2
Synonyms: Cog2, 2700012E02Rik, 1190002B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76332
HGNC: HGNC:6546
Homologene: 7206
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b1702Clo, b2b288Clo, m687Ddg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Syne4
Name: spectrin repeat containing, nuclear envelope family member 4
Synonyms: nesprin-4, 0610012K07Rik, AI428936
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233066
Homologene: 17716
Fam227a
Name: family with sequence similarity 227, member A
Synonyms: 4933432B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 75729
Homologene: 123434
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22625
Homologene: 19318
Cep89
Name: centrosomal protein 89
Synonyms: 2610507L03Rik, Ccdc123
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72140
Homologene: 12444
Tm6sf2
Name: transmembrane 6 superfamily member 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 107770
Homologene: 77694
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Cttnbp2
Name: cortactin binding protein 2
Synonyms: 4732477G22Rik, 3010022N24Rik, Cortbp2, 9130022E09Rik, ORF4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30785
Homologene: 14125
Rgl1
Name: ral guanine nucleotide dissociation stimulator,-like 1
Synonyms: Rgl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19731
Homologene: 9039
Nnmt
Name: nicotinamide N-methyltransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18113
HGNC: HGNC:7861
Homologene: 4496
Or7g33
Name: olfactory receptor family 7 subfamily G member 33
Synonyms: MOR154-1, Olfr853, GA_x6K02T2PVTD-13277703-13276786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258908
HGNC: HGNC:8466
Homologene: 133623
Asprv1
Name: aspartic peptidase, retroviral-like 1
Synonyms: 2300003P22Rik, TPA-induced aspartic proteinase-like, SASP, Taps, SASPase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67855
Homologene: 23582
Or4g16
Name: olfactory receptor family 4 subfamily G member 16
Synonyms: Olfr1279, MOR245-12, GA_x6K02T2Q125-72357646-72358581
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258388
Homologene: 121520
Vmn1r25
Name: vomeronasal 1 receptor 25
Synonyms: V1rc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 113865
Homologene: 137652
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329679
Homologene: 46417
Atp8a2
Name: ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonyms: wl, agil, Ib
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 108168164
Homologene: 4443
Garin1a
Name: golgi associated RAB2 interactor 1A
Synonyms: Fam71f2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 245884
Homologene: 52974
Cfap61
Name: cilia and flagella associated protein 61
Synonyms: 4930529M08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78774
Thoc5
Name: THO complex 5
Synonyms: A430085L24Rik, PK1.3, Fmip, 1700060C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 107829
Homologene: 37836
Ajm1
Name: apical junction component 1
Synonyms: Gm996, LOC381353
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381353
Homologene: 19943
Klhl22
Name: kelch-like 22
Synonyms: 2610318I18Rik, Kelchl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224023
Homologene: 23784
Kif1c
Name: kinesin family member 1C
Synonyms: N-3 kinsin, D11Bwg1349e, Orch3, B430105J22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16562
HGNC: HGNC:6317
Homologene: 4821
Ppil6
Name: peptidylprolyl isomerase (cyclophilin)-like 6
Synonyms: 2900084F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73075
VEGA: 10
Homologene: 52155
Srd5a2
Name: steroid 5 alpha-reductase 2
Synonyms: 5ART2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 94224
VEGA: 17
Homologene: 37292
Creg2
Name: cellular repressor of E1A-stimulated genes 2
Synonyms: A830098L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 263764
Homologene: 17827
Ikzf2
Name: IKAROS family zinc finger 2
Synonyms: Helios, Zfpn1a2, A730095J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22779
Homologene: 22659
Thap3
Name: THAP domain containing, apoptosis associated protein 3
Synonyms: 2010013E08Rik, 2210418H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69876
Homologene: 18413
Phf11a
Name: PHD finger protein 11A
Synonyms: Phf11, 4933417L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219131
Homologene: 87807
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Acox3
Name: acyl-Coenzyme A oxidase 3, pristanoyl
Synonyms: pristanoyl-CoA oxidase, EST-s59, PCOX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80911
HGNC: HGNC:121
Homologene: 37792
Pced1b
Name: PC-esterase domain containing 1B
Synonyms: Fam113b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239647
VEGA: 15
Homologene: 16301
Gm7276
Name: predicted gene 7276
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108168393
VEGA: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 39,623,204 bp
  • T to A, chromosome 1 at 69,538,814 bp
  • T to A, chromosome 1 at 127,817,656 bp
  • C to A, chromosome 1 at 134,747,620 bp
  • T to C, chromosome 1 at 152,533,575 bp
  • T to A, chromosome 1 at 160,959,423 bp
  • T to C, chromosome 1 at 190,937,467 bp
  • T to C, chromosome 2 at 25,579,155 bp
  • T to C, chromosome 2 at 59,310,303 bp
  • C to A, chromosome 2 at 76,830,856 bp
  • C to T, chromosome 2 at 110,733,898 bp
  • T to C, chromosome 2 at 111,306,771 bp
  • T to C, chromosome 2 at 111,408,753 bp
  • T to C, chromosome 2 at 146,035,319 bp
  • T to G, chromosome 3 at 32,534,322 bp
  • A to C, chromosome 3 at 32,590,039 bp
  • A to G, chromosome 3 at 79,515,149 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • T to C, chromosome 3 at 135,594,957 bp
  • T to C, chromosome 4 at 42,970,215 bp
  • T to A, chromosome 4 at 129,657,471 bp
  • C to T, chromosome 4 at 151,985,704 bp
  • A to T, chromosome 5 at 35,603,027 bp
  • A to T, chromosome 5 at 96,598,909 bp
  • T to A, chromosome 5 at 118,749,748 bp
  • A to T, chromosome 6 at 18,434,983 bp
  • G to C, chromosome 6 at 29,285,938 bp
  • T to A, chromosome 6 at 52,736,912 bp
  • A to T, chromosome 6 at 57,978,461 bp
  • T to C, chromosome 6 at 73,124,778 bp
  • A to G, chromosome 6 at 86,628,736 bp
  • G to A, chromosome 6 at 89,651,485 bp
  • G to T, chromosome 6 at 92,880,623 bp
  • A to G, chromosome 6 at 108,482,897 bp
  • A to G, chromosome 7 at 25,363,847 bp
  • A to T, chromosome 7 at 29,101,738 bp
  • A to G, chromosome 7 at 30,316,222 bp
  • A to C, chromosome 7 at 30,532,323 bp
  • A to G, chromosome 7 at 35,417,680 bp
  • A to T, chromosome 7 at 46,692,800 bp
  • G to T, chromosome 7 at 90,475,971 bp
  • T to C, chromosome 7 at 107,074,274 bp
  • A to G, chromosome 8 at 13,035,209 bp
  • G to T, chromosome 8 at 70,078,930 bp
  • T to C, chromosome 8 at 79,372,029 bp
  • G to A, chromosome 8 at 104,737,555 bp
  • A to G, chromosome 8 at 111,479,362 bp
  • T to C, chromosome 8 at 124,542,890 bp
  • C to T, chromosome 9 at 19,537,328 bp
  • A to G, chromosome 9 at 48,604,874 bp
  • C to T, chromosome 9 at 62,797,274 bp
  • T to A, chromosome 9 at 102,730,096 bp
  • A to G, chromosome 10 at 41,514,180 bp
  • T to C, chromosome 10 at 125,997,701 bp
  • A to G, chromosome 11 at 4,919,792 bp
  • C to T, chromosome 11 at 70,728,397 bp
  • A to G, chromosome 11 at 78,155,161 bp
  • T to C, chromosome 11 at 85,210,110 bp
  • A to T, chromosome 11 at 107,491,906 bp
  • A to T, chromosome 11 at 118,121,495 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to A, chromosome 12 at 70,255,113 bp
  • A to T, chromosome 12 at 100,149,860 bp
  • T to C, chromosome 12 at 110,656,357 bp
  • C to T, chromosome 13 at 3,573,860 bp
  • C to A, chromosome 13 at 55,631,971 bp
  • T to A, chromosome 13 at 99,431,929 bp
  • A to G, chromosome 13 at 100,693,573 bp
  • T to C, chromosome 14 at 28,518,343 bp
  • A to T, chromosome 14 at 59,280,788 bp
  • T to C, chromosome 14 at 59,860,186 bp
  • A to T, chromosome 14 at 108,911,927 bp
  • A to C, chromosome 15 at 58,191,469 bp
  • G to A, chromosome 15 at 79,620,677 bp
  • A to G, chromosome 15 at 89,253,051 bp
  • A to G, chromosome 15 at 97,384,713 bp
  • A to T, chromosome 15 at 99,707,638 bp
  • C to A, chromosome 16 at 17,776,488 bp
  • A to C, chromosome 16 at 38,510,717 bp
  • A to G, chromosome 17 at 8,898,870 bp
  • A to G, chromosome 17 at 21,509,504 bp
  • G to A, chromosome 17 at 24,377,842 bp
  • A to G, chromosome 17 at 73,188,004 bp
  • A to T, chromosome 17 at 74,021,481 bp
  • T to A, chromosome 18 at 34,628,591 bp
  • G to A, chromosome 18 at 50,160,215 bp
  • T to C, chromosome 18 at 62,412,234 bp
  • C to A, chromosome 18 at 77,185,570 bp
  • T to C, chromosome 18 at 89,042,129 bp
  • A to G, chromosome 19 at 3,267,246 bp
  • A to T, chromosome 19 at 10,629,080 bp
  • A to T, chromosome 19 at 17,447,574 bp
  • A to T, chromosome 19 at 47,278,320 bp
  • A to G, chromosome 19 at 53,625,065 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1661 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039697-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.