Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1661Btlr/Mmmh
Stock Number:
039697-MU
Citation ID:
RRID:MMRRC_039697-MU
Other Names:
R1661 (G1), C57BL/6J-MtgxR1661Btlr
Major Collection:

Strain Information

Htr4
Name: 5 hydroxytryptamine (serotonin) receptor 4
Synonyms: 5-HT4L, 5-HT4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15562
VEGA: 18
HGNC: HGNC:5299
Homologene: 20243
Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: roquin, 5730557L09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381305
Homologene: 19036
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Mfn1
Name: mitofusin 1
Synonyms: 6330416C07Rik, 2310002F04Rik, D3Ertd265e, HR2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67414
Homologene: 11481
Lrig3
Name: leucine-rich repeats and immunoglobulin-like domains 3
Synonyms: 9030421L11Rik, 9130004I02Rik, 9430095K15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320398
VEGA: 10
Homologene: 62452
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Timmdc1
Name: translocase of inner mitochondrial membrane domain containing 1
Synonyms: 2810021C21Rik, 4930455C21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 76916
HGNC: HGNC:1321
Homologene: 9578
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 39,623,204 bp
  • T to A, chromosome 1 at 69,538,814 bp
  • T to A, chromosome 1 at 127,817,656 bp
  • C to A, chromosome 1 at 134,747,620 bp
  • T to C, chromosome 1 at 152,533,575 bp
  • T to A, chromosome 1 at 160,959,423 bp
  • T to C, chromosome 1 at 190,937,467 bp
  • T to C, chromosome 2 at 25,579,155 bp
  • T to C, chromosome 2 at 59,310,303 bp
  • C to A, chromosome 2 at 76,830,856 bp
  • C to T, chromosome 2 at 110,733,898 bp
  • T to C, chromosome 2 at 111,306,771 bp
  • T to C, chromosome 2 at 111,408,753 bp
  • T to C, chromosome 2 at 146,035,319 bp
  • T to G, chromosome 3 at 32,534,322 bp
  • A to C, chromosome 3 at 32,590,039 bp
  • A to G, chromosome 3 at 79,515,149 bp
  • C to T, chromosome 3 at 96,651,738 bp
  • T to C, chromosome 3 at 135,594,957 bp
  • T to C, chromosome 4 at 42,970,215 bp
  • T to A, chromosome 4 at 129,657,471 bp
  • C to T, chromosome 4 at 151,985,704 bp
  • A to T, chromosome 5 at 35,603,027 bp
  • A to T, chromosome 5 at 96,598,909 bp
  • T to A, chromosome 5 at 118,749,748 bp
  • A to T, chromosome 6 at 18,434,983 bp
  • G to C, chromosome 6 at 29,285,938 bp
  • T to A, chromosome 6 at 52,736,912 bp
  • A to T, chromosome 6 at 57,978,461 bp
  • T to C, chromosome 6 at 73,124,778 bp
  • A to G, chromosome 6 at 86,628,736 bp
  • G to A, chromosome 6 at 89,651,485 bp
  • G to T, chromosome 6 at 92,880,623 bp
  • A to G, chromosome 6 at 108,482,897 bp
  • A to G, chromosome 7 at 25,363,847 bp
  • A to T, chromosome 7 at 29,101,738 bp
  • A to G, chromosome 7 at 30,316,222 bp
  • A to C, chromosome 7 at 30,532,323 bp
  • A to G, chromosome 7 at 35,417,680 bp
  • A to T, chromosome 7 at 46,692,800 bp
  • G to T, chromosome 7 at 90,475,971 bp
  • T to C, chromosome 7 at 107,074,274 bp
  • A to G, chromosome 8 at 13,035,209 bp
  • G to T, chromosome 8 at 70,078,930 bp
  • T to C, chromosome 8 at 79,372,029 bp
  • G to A, chromosome 8 at 104,737,555 bp
  • A to G, chromosome 8 at 111,479,362 bp
  • T to C, chromosome 8 at 124,542,890 bp
  • C to T, chromosome 9 at 19,537,328 bp
  • A to G, chromosome 9 at 48,604,874 bp
  • C to T, chromosome 9 at 62,797,274 bp
  • T to A, chromosome 9 at 102,730,096 bp
  • A to G, chromosome 10 at 41,514,180 bp
  • T to C, chromosome 10 at 125,997,701 bp
  • A to G, chromosome 11 at 4,919,792 bp
  • C to T, chromosome 11 at 70,728,397 bp
  • A to G, chromosome 11 at 78,155,161 bp
  • T to C, chromosome 11 at 85,210,110 bp
  • A to T, chromosome 11 at 107,491,906 bp
  • A to T, chromosome 11 at 118,121,495 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • T to A, chromosome 12 at 70,255,113 bp
  • A to T, chromosome 12 at 100,149,860 bp
  • T to C, chromosome 12 at 110,656,357 bp
  • C to T, chromosome 13 at 3,573,860 bp
  • C to A, chromosome 13 at 55,631,971 bp
  • T to A, chromosome 13 at 99,431,929 bp
  • A to G, chromosome 13 at 100,693,573 bp
  • T to C, chromosome 14 at 28,518,343 bp
  • A to T, chromosome 14 at 59,280,788 bp
  • T to C, chromosome 14 at 59,860,186 bp
  • A to T, chromosome 14 at 108,911,927 bp
  • A to C, chromosome 15 at 58,191,469 bp
  • G to A, chromosome 15 at 79,620,677 bp
  • A to G, chromosome 15 at 89,253,051 bp
  • A to G, chromosome 15 at 97,384,713 bp
  • A to T, chromosome 15 at 99,707,638 bp
  • C to A, chromosome 16 at 17,776,488 bp
  • A to C, chromosome 16 at 38,510,717 bp
  • A to G, chromosome 17 at 8,898,870 bp
  • A to G, chromosome 17 at 21,509,504 bp
  • G to A, chromosome 17 at 24,377,842 bp
  • A to G, chromosome 17 at 73,188,004 bp
  • A to T, chromosome 17 at 74,021,481 bp
  • T to A, chromosome 18 at 34,628,591 bp
  • G to A, chromosome 18 at 50,160,215 bp
  • T to C, chromosome 18 at 62,412,234 bp
  • C to A, chromosome 18 at 77,185,570 bp
  • T to C, chromosome 18 at 89,042,129 bp
  • A to G, chromosome 19 at 3,267,246 bp
  • A to T, chromosome 19 at 10,629,080 bp
  • A to T, chromosome 19 at 17,447,574 bp
  • A to T, chromosome 19 at 47,278,320 bp
  • A to G, chromosome 19 at 53,625,065 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1661 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039697-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.